1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
11

What reacts with sulfur dioxide in

Biology
1 answer:
vekshin13 years ago
7 0

Answer:

Acid rain is caused by emissions of sulphur dioxide and nitrogen oxide, which react with the water molecules in the atmosphere to produce acids.

You might be interested in
All adults over the age of 40 experience age-related bone loss. what is the term for this condition?
MakcuM [25]
The answer would be osteoporosis

Osteoporosis comes from word osteo- which mean bones and -porosis which means "pore". The term is used to describe a decrease in bone density which makes them seems like having multiple pores. It is found more in the old patient because the bone formation is decreased.
3 0
3 years ago
What is marked by the decrease of the male hormone testosterone? andropause amenorrhea amdropause menopause submit?
Gelneren [198K]
The decrease of testosterone in males is called andropause. This happens when a man reaches the age of 40 where there is a gradual decrease in their testosterone; about one percent less each year. Symptoms of andropause include, depression, insomnia, increased body fat, and difficulty concentrating.
5 0
3 years ago
What is the difference between osmosis and diffusion
Vinil7 [7]

Answer:

first question:  3. osmosis is a kind of diffusion that involves the movement of water

2nd question:  1. it allows carbon dioxide to move in and out of the cell

Explanation:

5 0
3 years ago
What is the difference between the sympathetic and parasympathetic division of the nervous system?.
Papessa [141]

Answer:

The sympathetic nervous system is involved in preparing the body for stress related activities; the parasympathetic nervous system is associated with returning the body to routine, day-to-day operations. The two systems have complementary functions, operating in tandem to maintain the body's homeostasis.

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • Which two habitats lack trees, shrubs, and liquid water?
    5·2 answers
  • Male birds of two different species living on the same island have developed different mating behaviors, as
    15·1 answer
  • What would MOST LIKELY happen to the grass if most of the fungi and bacteria die?
    13·2 answers
  • Match the following terms and definitions.
    9·2 answers
  • An injury to the olecranon would most likely cause pain and disuse of which joint?
    13·2 answers
  • What do vacuoles and golgi bodies have in common?
    5·1 answer
  • Fungi of the phylum Basidiomycota form mycorrhizal associations with orchids, a type of flowering plant. How do these associatio
    14·2 answers
  • Similarities between the DNA of certain bacteria and the DNA of both mitochondria and chloroplasts is evidence that these organe
    14·1 answer
  • Please don’t answer just for points if you don’t know and links will be reported
    11·2 answers
  • The type of cartilage that forms the long bones of the embryonic skeleton is:.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!