1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
7

I will mark brainest if you get it right

Biology
2 answers:
blsea [12.9K]3 years ago
7 0
Inexhaustible means unlimited, so if inexhaustible means unlimited, the answer would be C.
Anika [276]3 years ago
4 0

Answer:

c

Explanation:

C. We will never run out.

sooooooooooo can i get bralist

You might be interested in
The organelles that produce proteins used within the cell are the _____.?
Butoxors [25]
Nucleus, ribosomes, endoplasmic reticulum, and <span>Golgi apparatus.</span>
8 0
3 years ago
Read 2 more answers
You cross a plant with red flowers with a plant with white flowers.both plants are pure-breeding all the offsprings have pink fl
kkurt [141]
It’s because of the dominant trait
6 0
3 years ago
Chemosynthesis relies on chemical energy in the environment. The fact that no large organisms are known to undergo chemosynthesi
Aleksandr-060686 [28]

Answer:

The correct answer is chemical energy in the environment is weaker than light energy.

Explanation:

yw :)

4 0
2 years ago
Cell wall is secreted by:<br> (a)nucleoplasm (b)golgi complex (c)ribosomes (d)protoplasm
Mumz [18]

Answer:

A

Explanation:

4 0
3 years ago
I need help please<br> I need help <br> I need help
olchik [2.2K]
The answer is d/ the fourth one
4 0
3 years ago
Other questions:
  • You have isolated a particular virus and have found that the amount of thymine present in its double stranded DNA is 23%. Based
    8·1 answer
  • Which transport process always involves the movement of materials from inside the cell to outside the cell?
    15·2 answers
  • The blood group B is almost absent in Native Americans, whose ancestors arrived in very small numbers about 10,000 years ago. Wh
    8·1 answer
  • 1. List the three parts to the cell theory.
    6·2 answers
  • Blood returning from the lungs enters theA. Left atriumB. Left ventricleC. Right atriumD. Right ventricleE. Aorta
    9·1 answer
  • If part of the xylem of a young oak tree is destroyed which of the following functions would it intere with most
    15·2 answers
  • I need help ASAP it’s due in 30 mins
    7·1 answer
  • What is a niche related to organism​
    5·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • What is the role of lay person like you in the mission of the church today?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!