1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Papessa [141]
2 years ago
7

Which ion(s) would bond by electrostatic attraction with an ion of Fluorine?

Chemistry
1 answer:
satela [25.4K]2 years ago
4 0

Answer:

Intermolecular forces (IMF) (or secondary forces) are the forces which mediate interaction between atoms, including forces of attraction or repulsion which act between atoms and other types of neighboring particles, e.g. atoms or ions. Intermolecular forces are weak relative to intramolecular forces – the forces which hold a molecule together. For example, the covalent bond, involving sharing electron pairs between atoms, is much stronger than the forces present between neighboring molecules. Both sets of forces are essential parts of force fields frequently used in molecular mechanics.

Explanation:

You might be interested in
Use the periodic table to choose the element that matches each description.
nika2105 [10]

Using the periodic table to choose the element that matches each description include the following below:

  • Halogen: iodine
  • Group IIA: magnesium
  • Nonreactive: argon
  • Alkali metal: potassium.

<h3>What is a Periodic table?</h3>

This contains elements which are arranged according to the order of their atomic number in a tabular form. There are 18 groups which are the vertical columns present while there are 8 periods which are the horizontal rows present in the periodic table.

Example of an alkali metal is potassium while the non reactive ones include argon, neon etc. Examples of halogens include chlorine, iodine etc. are the ones which have seven electrons in their outer electron shells thereby just requiring one electron to achieve to obtain a stable octet configuration.

These are therefore the elements which match the descriptions provided in this case and is the most appropriate choice.

Read more about Periodic table here brainly.com/question/15987580

#SPJ1

8 0
1 year ago
How has the fishing industry along the Chesapeake Bay changed in the last 25 years?
zhuklara [117]

Answer:

In the last 25 years, the fish hunt in the Chesapeake Bay occurred very fastly due to which the fish industry enhanced. However, this rapid fish industrialization caused many of the fish species to become endangered. Hence, the fish industries started to use two basic management techniques which were conservation and allocation.

3 0
3 years ago
Examine the chemical equation Al + O2 Al2O3
AURORKA [14]
I think it is aluminum oxide

5 0
3 years ago
the speed limit is posted as 35 km/hr . your speedometer reads that you are going 40 miles/hr. are you speeding?
Morgarella [4.7K]
No, because 40 miles is the same as nearly 25 km/h. 
4 0
3 years ago
What is scientific "law"?
Natalka [10]
Based on (repeated) experiments or observations, that describe or predict a range of natural phenomena. the answer is c (sorry if i’m incorrect)
4 0
3 years ago
Other questions:
  • Name: Date:
    11·1 answer
  • PL ZHELP plzZZZZZZZZZZZZZZZZZZZ
    9·2 answers
  • Based on the units given for displacement and time, what will the units for velocity be?
    12·1 answer
  • Determine the volume at STP of 36.8 g of nitrogen dioxide (NO2)
    6·1 answer
  • Which of the following was a major contribution to chemistry by Antoine Lavoisier
    11·1 answer
  • Complete the chart
    15·1 answer
  • A 60.0 g sample of chromium at 82.0°C (specific heat for chromium is 0.11 J/g°C) was placed in 80.0 g of water. Assume there is
    15·1 answer
  • Winds in the Northern Hemisphere shift in a clockwise direction. What cause this change in direction?
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of these statements about the Plum-Pudding Model is incorrect?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!