1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amiraneli [1.4K]
3 years ago
11

Name two organs that are easy to repair using stem cells. What are two organs that are difficult to repair using stem cells?

Biology
1 answer:
n200080 [17]3 years ago
4 0
The skin and the liver are two organs that would be easy for stem cells to repair. What would be difficult to repair would be the apical meristem and the lateral.
You might be interested in
HELP PLZZZZZZZZZZZZZZZZ
Zielflug [23.3K]

Answer:

moving materials in and waste products out

Explanation:

6 0
3 years ago
Which of the following correctly describes the difference between transcription and translation?
g100num [7]
A) Transcription makes RNA from DNA, translation turns RNA into proteins.
3 0
3 years ago
Read 2 more answers
What are feeds with low fiber content and a high nutrient content?
marysya [2.9K]

Answer:

Feeds that are high in energy include greater than 70% Total Digestible Nutrients (TDN) and low in fibre includes less than 18% Carbon fibers  (CF) and less than 20% protein.

Feeds with low fiber content and a high nutrient content includes Cereal grains such as wheat, barley, corn, oats, rye, and sorghum grain.

8 0
3 years ago
What is the best over-the-counter medicine for restless leg syndrome.
Delvig [45]

Answer:

Aspirin, ibuprofen, or acetaminophen.

Explanation:

7 0
3 years ago
What terms or expression helps to distinguish positive from negative feedback?
Sholpan [36]

Explanation:

positovo siempreeeeee

6 0
3 years ago
Other questions:
  • What does a pulley consist of
    11·2 answers
  • Kiera is performing an experiment. She completed her first experimental trial and recorded the result. When she repeated the tri
    14·1 answer
  • Which of the following best compares mosses and ferns?
    12·2 answers
  • Which of the following is the main purpose of mitosis? A. to copy the cell’s DNA B. to divide the cytoplasm C. to help the cell
    10·1 answer
  • Where will a hydrophilic amino acid usually position itself during protein folding
    14·1 answer
  • _______________ are a family of antianxiety drugs that includes diazepam (valium) and alprazolam (xanax).
    10·1 answer
  • A client with eczema has a prescription for a topical corticosteroid. the nurse cautions the client to use the product carefully
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Can anyone help me please
    6·1 answer
  • What would happen if I jump out of a plane without my parachute
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!