1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
2 years ago
6

Which of the following statements is FALSE?

Chemistry
1 answer:
vovikov84 [41]2 years ago
3 0

Answer: ITS FALSE

ExplaC6H12 + 9 O2 → 6 H2O + 6 CO2 is a single replacement reaction

nation:

You might be interested in
Empirical formula for 6. 63.52% Fe, 36.48% S
emmasim [6.3K]
The empirical formula for this would be FeS
8 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
What acids in alcohol make it evaporate
fgiga [73]

The acids found in alcohol that make it evaporate are called organic acids.

An organic acid is an organic compound that has acidic properties. There are two types: one has a carboxyl (COOH) group, and the other type has a phenol group.

The most common organic acids are those with a carboxyl group and include acetic acid, formic acid, lactic acid and all fatty acids.  Perfumes  include organic acid in their composition to make them volatile. Volatile substances evaporate easily, and this is important for perfumes. They need to dissipate easily into the surrounding environment and spread their good smell. 




6 0
3 years ago
Write the formulas for the ionic compounds formed by the following:
PSYCHO15rus [73]

1. KI

2. AlBr₃

3. CsNO₃

4. Al₂(CO₃)₃

Explanation:

1. potassium (K⁺) iodine (I⁻) - KI

2. aluminium (Al³⁺) bromine (Br⁻) - AlBr₃

3. caesium (Cs⁺) nitrate (NO₃⁻) - CsNO₃

4. aluminum (Al³⁺) carbonate (CO₃²⁻)  - Al₂(CO₃)₃

Learn more about:

formulas for the ionic compounds

brainly.com/question/13954262

#learnwithBrainly

7 0
3 years ago
a chemical reaction produced 2.50 moles of nitrogen gas. what volume in liters, does this gas sample occupy at STP? (show your w
Harrizon [31]

The volume of N₂ at STP=56 L

<h3>Further explanation</h3>

Given

2.5 moles of N₂

Required

The volume of the gas

Solution

Conditions at T 0 ° C and P 1 atm are stated by STP (Standard Temperature and Pressure). At STP, the volume per mole of gas or the molar volume-Vm is 22.4 liters/mol.

So for 2.5 moles gas :

\tt 2.5\times 22.4=56~L

5 0
2 years ago
Other questions:
  • Which element has chemical properties that are most similar to the chemical properties of sodium?
    8·1 answer
  • 2 The addition of nutrients to water by human<br> activity is called artificial______
    5·2 answers
  • What pressure is required to achieve a co2 concentration of 5.80×10−2 m at 20∘c?
    10·1 answer
  • Which question about dogs could be answered through investigation
    10·1 answer
  • Hydrobromic acid dissolves solid iron according to the following reaction:
    14·1 answer
  • Calculate the number of oxygen atoms and its mass in 50g of CaCo3<br>​
    14·1 answer
  • If temperature is constant, the relationship between pressure and volume is<br> **direct**
    8·1 answer
  • Please help me?? i've been stuck on this for a while
    5·1 answer
  • How is steal wool and oxygen making iron oxide a chemical reaction? Why?
    5·1 answer
  • Which of the following is an oxidation-reduction reaction?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!