You asked which theory is most widely accepted describing the formation of our universe? …. Big Bang Theory
<em><u>The MC1R gene provides instructions for making a protein called the melanocortin 1 receptor. </u></em>
Explanation:
MC1R’s function-This receptor plays an important role in normal pigmentation. The receptor is primarily located on the surface of melanocytes, which are specialized cells that produce a pigment called melanin.
<h3 /><h3>
<em><u> I hope it'll help you...</u></em></h3>
WATER
Solids will usually sink when placed in their own liquids with the exception of water
Explanation:
Ice (the solid form of water) floats on water that is cooler than 4 degrees centigrade. This is unlike any other material and this phenomenon has been referred to as the ‘water anomaly’.
Most substances will sink in their own liquid because the solid form is denser than the amount of their own liquid that they displace when immersed. This is because the particles in the solid are closely packed together hence there are more particles per volume than in the liquid form.
Water however, expands at temperatures below 4 degrees and hence ice is less dense than water at 4 degrees and below. The particles in ice are farther apart than particles of water at 4 degrees and below. There is, therefore, more particles per volume in the liquid form of water than in ice – making ice less dense.
Learn More:
For more on 'water anomaly' check out;
brainly.com/question/871737
#LearnWithBrainly
I believe it is A- Stored Energy.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
