Answer:
No
Explanation:
Atomic number represents the identity of atoms
using number of protons which is equal in isotopes.
Technically molar mass cannot be in grams, it is in grams per mole. and it refers to a specific number of molecules of a substance, therefore substances have different molar masses because the elements have different weights. for example having 10 water molecules would be a lot heavier than having 10 air molecules
<u>Answer:</u> The correct answer is Option B.
<u>Explanation:</u>
Decomposition is a type of chemical reaction in which larger compound breaks down into two or more smaller compounds.
Double displacement reactions is defined as the chemical reaction in which exchange of ions takes place.
Synthesis reaction is a type of reaction in which two or more smaller compounds combines to form a single large compound.
Single displacement reaction is a type of reaction in which a more reactive metal displaces a less reactive metal from its chemical reaction.
In stomach, an acid is present known as hydrochloric acid and to neutralize its effect, antacid is taken which has 
as a component.
The reaction between HCl and 
is a type of neutralization reaction and it is a type of double displacement reaction.
The equation between the two follows:
Hence, the correct answer is Option B.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The correct option is STRONTIUM.
Strontium is a group 2 element, that means it has two electrons in its outermost shell. This element will prefer to lose these two electrons in its outermost shell in order to attain the octet form, therefore, it will form electrovalent bond with non metals which it can donate two electrons to.
