1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
11

I need help on this one​

Biology
1 answer:
sattari [20]3 years ago
3 0

Answer:

high tides on both sides

Explanation:

the ocean bulges outwards

You might be interested in
Mitosis can occur in both haploid and diploid cells, but meiosis cannot occur in haploid cells. Why not?.
allochka39001 [22]

Mitosis can occur in both haploid and diploid cells because it is equational division where the number of chromosomes remain the same after division. But meiosis cannot happen in haploid cells because it is reductional division and haploid cells do not have any extra copy of chromosomes to be halved.

Mitosis is the cell division where the number of chromosomes do not change after cell division. It usually happens in the somatic cells of the body. Cancer cells also undergo mitosis

Meiosis is the cell division where the number of chromosomes are halved after cell division. The process of meiosis occurs in two phases: meiosis I and meiosis II. The germ cells of the body undergo meiosis.

To know more about mitosis, here

brainly.com/question/26678449

#SPJ4

4 0
1 year ago
I don’t understand it’s confusing like I don’t like science and don’t know what to do can u help me plz
Anton [14]
The third one.……...................
3 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
What can you conclude about DNA from the idea that it is<br> like a cell's "brain"?
Trava [24]

Answer:

A cell cannot function without them

Explanation:

6 0
3 years ago
Which of these is a piece of evidence supporting the theory of evolution?
Veseljchak [2.6K]

Answer:

c)  Emus ostriches and meas are similar to the glyptodon

Explanation:

Only answer that supports the idea of evolution.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What functional groups will be joined together if alanine and serine molecules combine to form a single molecule?
    8·1 answer
  • All of the following might lead to a disease caused by an opportunistic pathogen except __________.
    6·1 answer
  • Please answer quick!! Given the following template strand, write in the sequence of the complementary DNA
    13·1 answer
  • Why is secondary lung cancer common?
    14·2 answers
  • Which shell adaptation did you choose for part two and why? Discuss the results and the effectiveness of the adaptation.
    8·1 answer
  • 4. Owls have large eyes that enable it to see well at night. Both the hawk and the owl hunt similar things: small rodents or sna
    8·1 answer
  • Which of the following is NOT one of the four main elements of an amino acid?
    13·1 answer
  • What are the similarities of a animal cell and a red blood cell
    13·1 answer
  • How does meiosis contribute to organisms being genetically diverse?.
    6·1 answer
  • What are the functions of the stratum corneum layer of the skin? select all that apply.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!