1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
10

Calculate the pH of a solution with [H+]= 1 x 10^-6M

Chemistry
1 answer:
Pie3 years ago
3 0

Answer:

pH=6

Explanation:

You might be interested in
Gaseous ethane will react with gaseous oxygen to produce gaseous carbon dioxide and gaseous water . Suppose 9.32 g of ethane is
Pie

Answer:

There will remain 8.06 grams of ethane

Explanation:

Step 1: Data given

Mass of ethane = 9.32 grams

Mass of oxygen = 12.0 grams

Molar mass ethane = 30.07 g/mol

Molar mass oxygen = 32.00 g/mol

Step 2: The balanced equation

2 C2H6 + 7 O2 → 4 CO2 + 6 H2O

Step 3: Calculate moles ethane

Moles ethane = mass ethane / molar mass ethane

Moles ethane = 9.32 grams / 30.07 g/mol

Moles ethane = 0.3099 moles

Step 4: Calculate moles oxygen

Moles oxygen = 12.0 grams / 32.0 g/mol

Moles oxygen = 0.375 moles

Step 5: Calculate the limiting reactant

For 2 moles ethane we need 7 moles O2 to produce 4 moles CO2 and 6 moles H2O

O2 is the limiting reactant. It will completely be consumed ( 0.375 moles)

Ethane is in excess. There will react 2/7 * 0.375 = 0.107 moles

There will remain 0.375 - 0.107 = 0.268 moles

Step 6: Calculate mass ethane

Mass ethane = moles ethane * molar mass ethane

Mass ethane = 0.268 moles * 30.07 g/mol

Mass ethane = 8.06 grams

There will remain 8.06 grams of ethane

7 0
3 years ago
Measure of the average kinetic energy of molecules in an in an object
algol13
Yes because molecules is solid
8 0
3 years ago
Lanthanium found in the......... period
Gnesinka [82]
I'm preatty sure it is in the periodic table xxx

5 0
3 years ago
A 1.0 L volume of gas at 27.0°C exerts a pressure of 85.5 K PA what will the pressure be at 127°C assume constant volume
Marianna [84]

Answer:

114 kPa

Explanation:

Using Gay-Lussac's law you get the equation \frac{P1}{T1} x \frac{P2}{T2} and converting celcius you get the final equation of \frac{85.5}{27+273}  x \frac{P2}{127+273} . After dividing 85.5 by 27+273(300) you get 0.285 and then you multiply 0.285 by 127+273 (400). You finally get 114 kPa

4 0
2 years ago
If 15 grams of Carbon dioxide is produced in a chemical reaction, how many grams of Carbon must be consumed in the reaction if w
Nata [24]

4.1g

Explanation:

Given parameters:

Mass of carbon dioxide = 15g

Mass of oxygen gas = 11g

Unknown:

Mass of carbon consumed = ?

Solution:

   Equation of the reaction:

                                              C +  O₂   →   CO₂

    To solve this problem from the balanced equation,  we have to use the amount of product formed and work to Carbon. This is because, we are sure of the amount of carbon dioxide formed but the amount of the given oxygen gas used is not precise.

  Number of moles of CO₂ = \frac{mass}{molar mass}

Molar mass of CO₂ = 12 + (16 x2) = 44g/mol

   Number of moles of CO₂ = \frac{15}{44} = 0.34mole

From the equation of the reaction;

              1 mole of CO₂  is produced from 1 mole of C

           0.34mole of CO₂  will produce 0.34mole of C

Mass of carbon reacting = number of moles x molar mass = 0.34 x 12 = 4.1g

Learn more:

Number of moles brainly.com/question/1841136

#learnwithBrainly

4 0
3 years ago
Other questions:
  • Write the number of atoms of each element found in one unit of the compound:
    8·2 answers
  • Calculate the volume of air in liters that you might inhale (and exhale) in 1.0 hour. Assume that each breath has a volume of 0.
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Is helium a gas, liquid or solid at room temperature
    11·1 answer
  • Like a greenhouse gas, clouds can trap heat emitted from the earth's surface.
    12·2 answers
  • Drag each tile to the correct box.
    14·1 answer
  • Which direction will the following reaction (in a 5.0 L flask) proceed if the pressure of CO_2(g) is 1.0 atm? CaCO_3(s) rightarr
    6·1 answer
  • In a titration to find the concentration of 30ml of a H2SO4 solution, a student found that 40ml of 0.2M KOH solution was needed
    8·1 answer
  • Can someone help me solve this? <br><br> Thanks!
    11·1 answer
  • Which statement below best describes kinetic energy?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!