1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
9

C. How do the drops of polar liquids differ from those of nonpolar liquids?

Chemistry
1 answer:
professor190 [17]3 years ago
8 0

Explanation:

Polar molecules or liquid are formed whenever the electronegativity separations of the bound atoms changes. Because once sharing of electrons equally between atoms in a diatomic molecule or even when polar bonds in a complex mixture cancel one another out, nonpolar compounds or liquid form.

You might be interested in
It has been hypothesized that a chemical known as BW prevents colds. To test this hypothesis, 20,000 volunteers were divided int
Amiraneli [1.4K]

Grams of BW

i think thats irtu9rgirg

8 0
3 years ago
What is the mass of oxygen in 10.0 g of water?
natita [175]

Answer:

The answer is 16.00 amu.

6 0
3 years ago
Read 2 more answers
After an investigation, Kuri determines that her hypothesis was wrong. What is the best thing for Kuri to do next?
weqwewe [10]
Make note of it and learn from her mistakes :)
3 0
3 years ago
How fast will benzene solidify
White raven [17]

Explanation:

What benzene is

Benzene is a chemical that is a colorless or light yellow liquid at room temperature. It has a sweet odor and is highly flammable.

Benzene evaporates into the air very quickly. Its vapor is heavier than air and may sink into low-lying areas.

Benzene dissolves only slightly in water and will float on top of water.

4 0
4 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • Is the unlimited source of energy for all living things is the leaf. Is that true or false
    14·1 answer
  • How does climate determine the organisms that live in a biome
    14·1 answer
  • Which of the following is not an example of kinetic energy? (2 points) Select one: a. mechanical energy b. nuclear energy c. ele
    7·2 answers
  • 0.80 g of hydrogen chloride (hcl is dissolved in water to make 5.5 l of solution. what is the ph of the resulting hydrochloric a
    14·1 answer
  • Which formula contains a metal and a nonmetal? SO2 MgO CO H2O
    15·2 answers
  • When CO2 decomposes into oxygen and carbon, it gives a gram ratio of 2.67:1 O2:C. When a 32.4g of CO2 decomposes, how many grams
    15·1 answer
  • Kp for the reaction CO2(g) + C(s) --- 2CO(g) is 1.47 at 727°C. Calculate Kc at this temperature.
    15·1 answer
  • The estimate obtained from a sample of which size is likely to be closest to
    15·2 answers
  • 3) During the day at 27°C a cylinder with a sliding top contains 20.0 liters
    14·1 answer
  • This is my question in imageIf 16.0 grams of aluminum oxide were actually produced, what is the percent yield of the reaction be
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!