1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
14

Are inic bonds formed when electrons are equally or unequally shared

Chemistry
1 answer:
lisabon 2012 [21]3 years ago
8 0

The electrons are unequally shared. The electronegative element receives the electrons from the electropositive one.

You might be interested in
Please help with this
dlinn [17]

Answer:

A sample of a gas (5.0 mol) at 1.0 atm is expanded at constant temperature from 10 L to 15 L. The final pressure is 0.67 atm.

Step by Step Explanation?

Boyle's law states that in constant temperature the variation volume of gas is inversely proportional to the applied pressure.

The formula is,

P₁ x V₁ = P₂ × V₂

Where,

P₁ is initial pressure = 1 atm

P2 is final pressure = ? (Not Known)

V₁ is initial volume = 10 L

V₂ is final volume = 15 L

Now put the values in the formula,

\begin{gathered}\rm 1\times 10 = P_2\times 15\\\\\rm P_2 = \frac{10}{15\\} \\\\\rm P_2 = 0.67\end{gathered]

Therefore, the answer is 0.67 atm.

5 0
2 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Be sure to answer all parts. A concentration cell consists of two Sn/Sn2+ half-cells. The electrolyte in compartment A is 0.23 M
kolbaska11 [484]

Answer:

Part A. The half-cell B is the cathode and the half-cell A is the anode

Part B. 0.017V

Explanation:

Part A

The electrons must go from the anode to the cathode. At the anode oxidation takes place, and at the cathode a reduction, so the flow of electrons must go from the less concentrated solution to the most one (at oxidation the concentration intends to increase, and at the reduction, the concentration intends to decrease).

So, the half-cell B is the cathode and the half-cell A is the anode.

Part B

By the Nersnt equation:

E°cell = E° - (0.0592/n)*log[anode]/[cathode]

Where n is the number of electrons being changed in the reaction, in this case, n = 2 (Sn goes from S⁺²). Because the half-reactions are the same, the reduction potential of the anode is equal to the cathode, and E° = 0 V.

E°cell = 0 - (0.0592/2)*log(0.23/0.87)

E°cell = 0.017V

3 0
3 years ago
Rahul and Sonia were playing with blocks and each of them made a train out of them. Both of them thought of measuring the length
dalvyx [7]

Answer:

See explanation

Explanation:

(a) The handspan is the distance between the tip of the thumb and tip of the little finger when the hand is fully stretched.

b) It is impossible for them to obtain an accurate result by the use of a handspan because it doesn't use any standard unit for measurement. It is entirely subjective and highly prone to human errors.

c) Anupam  is quite intelligent and active

3 0
3 years ago
Briefly explain the difference between hard water and soft water.​
melisa1 [442]

Answer:

I HOPE THE ABOVE INFORMATION WILL HELP YOU A LOT.

HAVE A NICE DAY.

3 0
3 years ago
Other questions:
  • What is the answer??
    8·2 answers
  • Calcium nitrate tetrahydrate dissolves in cold water to the extent of 266 g per 100 cm3. What is the concentration of nitrate io
    13·1 answer
  • How do you make life essence on little alchemy?<br> FIRST ONE to ANSWER gets BRAINLEST
    5·2 answers
  • Anna stated that ionic compounds have high melting points and low boiling points. She said that this demonstrates that ionic com
    11·2 answers
  • Ants live on acacia trees in South America. The ants feed on sugars secreted by the trees. The trees provide room for the ants t
    5·1 answer
  • Please help, due tomorrow! ツ
    8·1 answer
  • At 0°c a bottle contains a 325 mL of water in its liquid state. What is the volume of the water after it freezes (at 0°C)?
    5·1 answer
  • Which of the following best matches a part of a living cell with the function it performs?
    8·1 answer
  • Elabore el balance de la ecuación por oxido reducción enumerando cada paso
    9·1 answer
  • C₃H₈ (g) + 5O₂ (g) --&gt; 3CO₂ (g) + 4H₂O (l) would be best classified as which type of reaction?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!