1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
o-na [289]
3 years ago
12

What mass of NaOH would need to be dissolved in 500.0 mL of water to produce a solution with a pH of 12.40

Chemistry
1 answer:
Valentin [98]3 years ago
5 0

Answer:

0.5024 g

Explanation:

Step 1: Calculate the concentration of H⁺

We will use the definition of pH.

pH = -log [H⁺]

[H⁺] = antilog -pH = antilog -12.40 = 3.981 × 10⁻¹³ M

Step 2: Calculate the concentration of OH⁻

We will use the ionic product of water expression.

[H⁺] [OH⁻] = 10⁻¹⁴

[OH⁻] = 10⁻¹⁴/[H⁺] = 10⁻¹⁴/3.981 × 10⁻¹³ = 0.02512 M

Step 3: Calculate the initial concentration of NaOH

NaOH is a strong base and the molar ratio of NaOH to OH⁻is 1:1. Thus, the initial concentration of NaOH is 1/1 × 0.02512 M = 0.02512 M.

Step 4: Calculate the moles of NaOH

We will use the definition of molarity.

M = moles of NaOH/liters of solution

moles of NaOH = M × liters of solution

moles of NaOH = 0.02512 mol/L × 0.5000 L = 0.01256 mol

Step 5: Calculate the mass of 0.01256 moles of NaOH

The molar mass of NaOH is 40.00 g/mol.

0.01256 mol × 40.00 g/mol = 0.5024 g

You might be interested in
Liquid A and liquid B form a solution that behaves ideally according to Raoult's law. The vapor pressures of the pure substances
Rama09 [41]

Answer:

Vapor pressure of solution → 151.1 Torr

Option 2.

Explanation:

Raoult's Law is relationed to colligative property about vapor pressure. A determined solute, can make, the vapor pressure of solution decreases.

ΔP = P° . Xm

where Xm is the mole fraction of solute, P° (vapor pressure of pure solvent)

and ΔP = Vapor pressure of pure solvent - Vapor pressure of solution.

In order to determine the vapor pressure of solution, we need to determine, the vapor pressure of B and A in the solution

B's pressure = P° B . Xm

When we add A to B, A works as the solute and B, as the solvent.

Vapor pressure of pure B is 135 torr. (P° B)

In order to determine, the Xm, we use the moles of A and B

Xm = 5.3 mol of B / (1.28 + 5.3) → 0.806

B's pressure = 135 Torr . 0.806 → 108.81 Torr

If mole fraction of B is 0.806, mole fraction for A (solute) will be (1 - 0.806)

A's pressure = 218 Torr . 0.194 → 42.3 Torr

Vapor pressure of solution is sum of vapor pressures of solute + solvent.

Vapor pressure of solution = 42.3 Torr + 108.81 Torr → 151.1 Torr

6 0
3 years ago
A student wants to remove the salt from a mixture of sand and salt in order to get only pure sand. He adds water to the mixture.
raketka [301]

Answer:

Here is one way: Add water to the mixture. Only the sugar dissolves. This is a physical change.

Explanation:

The sugar would dissolve in water. You could then pour off the solution and wash the remaining sand with a bit more water. Heat the water to evaporate it from the sugar, and the two are separated.

5 0
3 years ago
Read 2 more answers
An ionic bond involves two elements...
valina [46]

Answer:

a metal and a nonmetal element

Explanation:

6 0
3 years ago
Which lists important roles of coral reefs?
Lena [83]
I believe the answer is C which is supporting a variety of organisms, cleaning oil from oceans, producing oxygen.
4 0
3 years ago
Read 2 more answers
What are the uses of carbon-14?
Gelneren [198K]

Carbon-14 is a radioactive isotope used to date organic material. Its consistent rate of decay allows the age of an object to be determined by the proportion of carbon-14 to other carbon isotopes. This process is called radiocarbon dating. Carbon-14 is also used as a radioactive tracer for medical tests.

6 0
3 years ago
Other questions:
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Pls help!! will give brainly
    8·2 answers
  • 45. most abundant metal in the earth's crust<br> 46. first discovered in light coming from the sun
    10·1 answer
  • The process by which dissolved gases are exchanged between the blood and interstitial fluids is
    7·1 answer
  • Water is produced from the reaction of hydrogen and oxygen gas, according to the equation below. What is the excess reactant in
    11·2 answers
  • Radiation is a measure of average kinetic energy of particles in an object true or false ​
    14·1 answer
  • Plz help with this digestive system
    9·2 answers
  • Use context clues to determine whether the bolded word in each sentence has a positive or negative connotation.
    5·2 answers
  • Please help this is due soon
    10·2 answers
  • A 0.216 g sample of carbon dioxide, CO2, has a volume of 507 mL and a pressure of 470 mmHg. What is the temperature of the gas i
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!