1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
11

Discuss how the nervous, circulatory, and respiratory systems interact with each other.

Biology
1 answer:
Liula [17]3 years ago
7 0

Explanation:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

You might be interested in
Someone give me pros and cons about cloning I have to do a essay about it
mylen [45]

Answer:

Pros:

Can extend lives

Can create organs

Help eliminate weak genes

Cure disorders

Cons:

Limits sense of individuality

Potential for faster aging

Can be used for exploitation

Debatable ethically

Hope this helps :0)

4 0
3 years ago
......................................................peridot​
Ilya [14]

Answer:

It's C. They are mostly made up of hydrogen and helium

4 0
3 years ago
A cat gives birth to kittens that do not look identical to either parent but rather look like a combination of both. however, a
ELEN [110]
Codominance and dominance of alleles
7 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
This food web represents a community in a rain forest.
kolbaska11 [484]

Answer:

coatis would increase

sloths would increase

fruit bats would increase

Explanation:

The boa constrictor in this food chain is the top predator, thus it is on the top of the food chain. It preys on several of the animals on this list, such as the coati, sloth, and fruit bats, so it is regulating their numbers. If the boa constrictor is removed from the ecosystem, the ecosystem will lose its predator, so the animals on which the boa constrictor preyed upon will have no threat, thus will experience rapid increase in their numbers. The coatis, sloths, and fruit bats, all will be predator free in this scenario, so they will all experience increase in their population, which in turn will have big effect on all other species in the ecosystem.

7 0
4 years ago
Other questions:
  • What is the bone that forms the superior border of the bony pelvis
    15·1 answer
  • PLEASE HELP FAST! Which best describes the purpose of a control sample? A. to have more quantitative data to analyze at the end
    13·2 answers
  • Messages in your brain are transmitted by
    11·1 answer
  • Where does the heat that warms your body come from ? explsin your answer?
    12·1 answer
  • Which temperature generated the greatest oxygen production?
    8·1 answer
  • One of the major elements of natural selection is that all<br> species have genetic
    7·2 answers
  • According to Charles Darwin theory of natural selection
    5·2 answers
  • Scientists have successfully inserted the human gene for insulin into bacteria.
    8·1 answer
  • From the pulmonary veins, blood flows to the _____.
    13·1 answer
  • Ayuda por favor doy corona​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!