1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
10

What is the volume of 55 grams of carbon dioxide at STP

Chemistry
1 answer:
e-lub [12.9K]3 years ago
7 0

Answer:

A. 2.45 L - Answer my answers is right.

You might be interested in
In the summer of 1859, Edwin Drake became the first person to strike oil in the United States while drilling in Titusville,_____
Nata [24]
C.Pennsylvania Titusville is in the state of Pennsylvania
7 0
3 years ago
Read 2 more answers
The atomic number of an atom is always equal to the total number of
Basile [38]
C is correct. Have a good day!
3 0
3 years ago
Read 2 more answers
4. When 1.00 L of 1.00 M Ba(NO3)2 solution at 25.0˚C is mixed with 1.00 L of 1.00 M Na2SO4 solution at 25.0˚C in a calorimeter,
myrzilka [38]

Answer:

The final temperature of the mixture is 28.11 °C

Explanation:

Step 1: Data given

Volume of 1.00 M Ba(NO3)2 = 1.00 L

Temperature = 25.0 °C

Volume of 1.00 M Na2SO4 = 1.00 L

enthalpy change is – 26 kJ per mol BaSO4

The specific heat of water is 4.18 J/g ·˚C

the density of water is 1.00 g/mL

Step 2: The balanced equation

Ba(NO3)2(aq) + Na2SO4(aq) → 2NaNO3(aq) + BaSO4(s)

Step 3: Calculate the total volume

Total volume = 1.00 L + 1.00 L = 2.00 L = 2000 mL

Step 4: Calculate mass

Mass = volume * density

Mass = 2000 mL * 1g/mL

Mass = 2000 grams

Step 5: Calculate moles BaSO4 formed

For 1 mol Ba(NO3)2 we need 1 mol Na2SO4 to produce 1 mol BaSO4

There is no limiting reactant, both Ba(NO3)2 and Na2SO4 will be completely be consumed (1 mol). We'll have 1.0 mol of BaSO4 produced.

Step 6: Calculate Q

Q = - ΔH

ΔH is negative so the reaction is exothermic, what means the temperature increases

Q is always positive, so Q = 26kJ = 26000 J

Step 6: Calculate the heat transfer

Q= m*c*ΔT

⇒with Q = the heat transfer = TO BE DETERMINED

⇒with m =the mass of the solution = 2000 grams

⇒with c= the specific heat of the solution = 4.18 J/g°C

⇒with ΔT = the change of temperature = T2 - T1 = T2 - 25.0

26000 = 2000 * 4.18 * (T2 - 25.0 °C)

3.11 = T2 - 25.0 °C

T2 = 25.0 + 3.11 °C

T2 = 28.11 °C

The final temperature of the mixture is 28.11 °C

7 0
3 years ago
how does photosynthesis and respiration in plants influence the amount of co2 in the atmosphere during a year?
Oliga [24]

Answer:

An increase in the amount of CO2 well increase the rate of photosynthesis, Carbon dioxide concentration will directly affect the rate of photosynthesis as it is used in the photosynthesis reaction.Increased amount of CO2 will increase the rate of photosynthesis to a certain limit, after which a further increase in its amount will no longer increase the rate any further.

Hope this helps.

Cheers! :)

8 0
3 years ago
When CaCO3(s) decomposes into CaO +CO2, the reaction is called?
liberstina [14]

\qquad \qquad\huge \underline{\boxed{\sf Answer}}

This reaction is called decomposition reaction, furthermore it can be said to be decomposition of limestone.

The balanced chemical equation for the reaction is ~

\qquad \sf  \dashrightarrow \: CaCO_3 = CaO + CO_2

5 0
2 years ago
Other questions:
  • The use of high-pressure chambers to control disease processes is known as
    11·1 answer
  • Is it possible for a molecular with polar bonds to be nonpolar?
    5·1 answer
  • Carbon forms two oxides in which the weight of oxygen combines with 1 g of carbon
    10·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Mechanical Advantage may be calculated using all of the following except ___.
    15·1 answer
  • chemist in South America claims to have discovered a new element with an atomic number of 34. An extremely rare element, it was
    12·1 answer
  • Sugars have a(n) __________ group that interacts with a _________ group that forms ring structures when the dry molecule is plac
    6·1 answer
  • The molar mass of Cr(OH)2 is:
    8·1 answer
  • The combustion of palmitic acid in a bomb calorimeter yields energy in the form of heat released upon oxidation. From a thermody
    7·1 answer
  • Pleasee help me I really need an answer help
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!