Answer:
Option (A).
Explanation:
Muscle contraction may be defined as the physiological process of the activation of tension generating sites that occur within the muscle fibers. Actin, myosin, troponin and other proteins are important for muscle contraction.
The calcium ion is important for the muscle contraction. The binding of calcium with troponin causes the movement of tropomyosin out of the grooves between the actin molecules during muscle contraction.
Thus, the correct answer is option (A).
Proteins, nucleic acids, and carbohydrates are grouped by common structural features found within their group. lipids can be grouped based on their high solubility in nonpolar solvents, and their preponderance of nonpolar groups.
Non-polar solvents cannot dissolve a polar compounds since no opposite charge exist, and the polar compound is not attracted. It is this becuase of absence of partial charge that also makes these molecules non-polar. Some of examples of non-polar solvents include benzene, hexane, pentane, toluene, etc.
Higher the solubility of a compound is that the larger the amount of the compound which can dissolve in a solution.
Learn more about nonpolar solvents here
brainly.com/question/14129775
#SPJ4
They multiply faster than other organisms
Ellular Respiration and Photosynthesis both have an ATP Synthase. These processes both have buildups of H+ and the ATP Synthase transports the hydrogen ions down the concentration gradient. This process is called Chemiosmosis.
<span>Similarities between Photosynthesis and Cellular Respiration.
</span><span>Cellular Respiration and Photosynthesis are both metabolic pathways. This means that the products created in Cellular Respiration are the reactants in Photosynthesis. While the products created in Photosynthesis are the reactants in Cellular Respiration. They are also metabolic pathways within themselves. In Photosynthesis, the products from the first phase (NADPH and ATP) are used in the second phase of Photosynthesis as a source of energy. In Cellular Respiration some products of glycolysis, intermediate step, Krebs Cycle are the reactants in Oxidation Phosphorylation. </span>
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
