1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
9

In a staple atom how does the number of protons compare to the number of electrons? HELP PLEASE !!!

Biology
1 answer:
Murrr4er [49]3 years ago
5 0
In an atom, the number of protons is almost always equal to the number of electrons
You might be interested in
A hormone involved in the removal of excess glucose from the blood is:
irakobra [83]

Answer:

glucagon

Explanation:

Glucagon is a hormone that is involved in controlling blood sugar (glucose) levels. It is produced by the alpha cells, found in the islets of Langerhans, in the pancreas, from where it is released into the bloodstream.

7 0
3 years ago
Which statement does NOT describe wind?
BlackZzzverrR [31]
I don’t know dear keep trying
5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
The neurohypophysis is another name for the anterior pituitary.<br> False<br> O True
AfilCa [17]

Answer:

false

Explanation:

checked on a website and it said that it was another name

5 0
2 years ago
Suppose that a patient is diagnosed with a new disease caused by the buildup of waste material in the body’s cells. Which organe
zysi [14]
The organelle that is most likely malfunctioning in the patient's cells would be B. Lysosomes.
6 0
2 years ago
Other questions:
  • All of the following are characteristics of monotremes, marsupials and placentals except A. hair. B. specialized teeth. C. mamma
    5·2 answers
  • Why can we sometimes hear noises in the stomach during digestion???
    14·1 answer
  • Suppose the number of organisms in one population in a community suddenly increases. Predict what might happen, and explain why.
    15·2 answers
  • What is osmosis? How does it work?
    15·1 answer
  • A student is studying the amino acid sequence of a protein shared by four organisms. The student wants to know which organism is
    11·1 answer
  • Is a crashed object from space that leaves a "dent".
    11·2 answers
  • explain how the understanding of atomic emission spectrum led to the development of the atomic theory
    13·2 answers
  • What are the formal charges on the sulfur (S), carbon (C), and nitrogen (N) atoms, respectively, in the resonance structure that
    10·1 answer
  • Why would cause a plant to stop growing?
    5·2 answers
  • In which other way do the skeletal and nervous system interact?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!