1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivann1987 [24]
3 years ago
13

Calculate the number of molecules in 7 moles of oxygen

Chemistry
1 answer:
Alexxandr [17]3 years ago
3 0

Answer:

4.21

Explanation:

use Avogadro's number

6.023 x 10^23

multiply this by 7 because you want to find 7 moles :

6.023 x 10^23 x 7 = 4.21

You might be interested in
The combustion of a sample of butane, C4H10 (lighter fluid), produced 2.46 grams of water.
avanturin [10]

a. 0.137

b. 0.0274

c. 1.5892 g

d. 0.1781

e. 5.6992 g

<h3>Further explanation</h3>

Given

Reaction

2 C4H10 + 13O2 -------> 8CO2 + 10H2O

2.46 g of water

Required

moles and mass

Solution

a. moles of water :

2.46 g : 18 g/mol = 0.137

b. moles of butane :

= 2/10 x mol water

= 2/10 x 0.137

= 0.0274

c. mass of butane :

= 0.0274 x 58 g/mol

= 1.5892 g

d. moles of oxygen :

= 13/2 x mol butane

= 13/2 x 0.0274

= 0.1781

e. mass of oxygen :

= 0.1781 x 32 g/mol

= 5.6992 g

6 0
3 years ago
Which words describe an air mass likely to be over the northern parts of the Pacific Ocean? wet and cold, warm and dry, cold and
liubo4ka [24]

Over the northern parts of the Pacific Ocean, the Maritime Polar air mass exists. This means that the air mass likely to be over the northern parts of the Pacific Ocean would be wet and cold.

6 0
3 years ago
Read 2 more answers
Balance the reaction ____Mo+___O2&gt; ___MoO3​
DIA [1.3K]

The balanced reaction is: 2Mo+3O2>2MoO3

7 0
2 years ago
Claude spends $315 to rent a car. The car he rents costs $45 per day. He has a coupon for 2 free days. Complete the equation bel
Julli [10]
$315 is your total cost of all
rent = 45 * numbers of days
d = numbers of days
45d
2 days free
45(d-2) = 315
Divide 45 to both sides
d-2 = 7
Add 2 to both sides
d = 9
So he rented for 9 days.
Hope this helps
5 0
3 years ago
Which set of products is most likely to result from the combustion reaction shown below?      C4H8(l) + 6O2(g)  
Fiesta28 [93]
The answer would be: carbon dioxide(CO2) and water (H2O).

The combustion of methane gas family typically will result in carbon dioxide and water. It will need many oxygen gases to do the combustion. The reaction equation would be: 

<span>C4H8(l) + 6O2(g)  ==> 4CO2 + 4H2O</span>
7 0
2 years ago
Other questions:
  • What best describes the path of the gas particles in a given
    15·1 answer
  • Explain the reaction of metals with water.<br><br>​
    6·1 answer
  • What state of matter has a defined volume and takes the shape of its container?
    6·1 answer
  • What is the identity of the atom shown?
    6·2 answers
  • The National Environmental Policy Act was established in 1965. True or false
    15·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Someone please help?!?
    8·1 answer
  • Based on context clues what is the meaning of tête-à-tête
    15·2 answers
  • Who want a brainliest? You do? Oh ok. Technically I have to write a question, so answer these...
    12·2 answers
  • 2 HBr(g)+O2(g)—&gt;H2O2(g)+Br2(g)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!