Answer:
I screenshot and expained here
https://screenshot.best/A7QIKV.lnk
Explanation:
Answer:
The ΔG° is 29 kJ and the reaction is favored towards reactant.
Explanation:
Based on the given information, the ΔH°rxn or enthalpy change is 41.2 kJ, the ΔS°rxn or change in entropy is 42.1 J/K or 42.1 * 10⁻³ kJ/K. The temperature given is 289 K. Now the Gibbs Free energy change can be calculated by using the formula,
ΔG° = ΔH°rxn - TΔS°rxn
= 41.2 kJ - 289 K × 42.1 × 10⁻³ kJ/K
= 41.2 kJ - 12.2 kJ
= 29 kJ
As ΔG° of the reaction is positive, therefore, the reaction is favored towards reactant.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Scirnce uses a method of testing to declare rules or facts. myth and fairy tales have no way of being tested. cats are a physical creature we can see, test, and observe. a mythical idea canny be tested. for example: mermaids cannot be tested as we have none to observe.
