1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
2 years ago
9

The graph models the linear relationship between the water level of the river in feet and number of days the water level measure

d. Which function can be used to find y, the water level of the river after x days

Biology
1 answer:
galina1969 [7]2 years ago
8 0

Answer:

option 4, y=1/4x+16

Explanation:

to solve this you must find the slope and the y intercept.

slope is rise/run, and equal to 2/8 or 1/4

then, the find the y intercept, find where the line crosses the y axis. Here it is 16.

finally you plug these answers into the slope intercept form, y=mx+b. In this form, m= slope, x=days, and b= y intercept.

after you plug in your answers you are left with y=1/4x+16.

You might be interested in
Which of the following codons code for threonine?
nordsb [41]
The answer is C.... ACA
3 0
3 years ago
Why is it important that psychologists understand biology in their efforts to better understand behavior and mental processes?
UNO [17]

Answer: By looking at the biological bases of human behavior, psychologists are better able to understand how the brain and physiological processes might influence the way people think, act, and feel.

4 0
2 years ago
What would happen if photosynthesis on Earth stopped?
Anvisha [2.4K]

The plants that use photosynthesis would die because the plants would not create food. They would die of hunger. Without another source of food, most of the animals would likewise die off to.
5 0
3 years ago
I really need someone to explain the 6 stages of mitosis
Akimi4 [234]

Answer:

Prophase; when the nuclear envelope breaks down,

prometaphase; the physical barrier that encloses the nucleus, called the nuclear envelope, breaks down

metaphase; The chromosomes line up across the center of the cell

anaphase; The centromeres split

telophase; The chromosomes begin to stretch out and lose their rod-like appearance

6 0
3 years ago
Science Experiment: Part 2
Naddik [55]

Answer:

ok

Explanation:

5 0
2 years ago
Other questions:
  • Which precautions would be used if mrsa and scabies are suspected?
    14·1 answer
  • Summarize how earth atmosphere and surface receive energy
    10·1 answer
  • Where do many of the cell's metabolic processes take place?
    9·1 answer
  • Some sea anemones can produce large colonies by reproducing asexually, but they can also produce planktonic larvae by reproducin
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the main disadvantage of a flat map?
    8·1 answer
  • When is energy released from ATP?
    13·1 answer
  • how do some cells beomce brain cells and others become skin cells, when the dna in all the cells is exactly the same. In other w
    14·2 answers
  • The male tubes that transport sperm from the testes are called?
    6·2 answers
  • True or false. Can you provide any evidence?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!