1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
9

What does the process of diffusion do for the cell? A. moves energy in the cell B. moves oxygen through the cell membrane C. mov

es water in and out of the cell D. moves proteins through the cell membrane
Biology
1 answer:
Liula [17]3 years ago
7 0
The process of diffusion moves oxygen through the cell membrane. Water moves in and out via aquaporins and other molecules go through protein channels. I would say that the answer is B
You might be interested in
Which letter on the graph shows exponential growth.
soldi70 [24.7K]

Answer:

Im think its C

Explanation:

Because in the Graph, thats the point where the line is mostly upward

4 0
3 years ago
a) ¿Qué utensilios de uso común y pensando en la contingencia sanitaria, podrían ser elaborados del cobre?
forsale [732]

Answer:

Hierro fundido.

Acero inoxidable.

Vidrio.

Bambú.

Cerámico.

quizás

Explanation:

4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Explain how scientists use geologic time to determine the age of landforms.
ch4aika [34]

Answer:

Researchers initially built up the geologic time scale by considering rock layers and record fossils around the world. With this data, researchers put in Earth's stone layers in request by relative age. Afterward, radioactive dating decided the supreme age of the divisions in the geologic time scale.

5 0
3 years ago
If you sort your results by relevance, what will be at the top of the results list?
Lina20 [59]
<span>Actually the information or data in the catalog DB or data base connection takes place by relevance and then mainly here we get the search string or required data which we want or entered, with clear exact search filters which has been directly chosen, and hence these will be at the top of the results list for sure.</span>
3 0
3 years ago
Other questions:
  • The continental United States is divided into two very large watersheds, one which drains into the _____ and the other into the
    12·1 answer
  • During a microscopic view of reproductive stages of bacteria cells, a tube connecting two bacterial cells was noticed. Which mod
    13·2 answers
  • How do ophelia and polonius react to her description of hamlets changed apperamnce?
    7·1 answer
  • Which is essential for finding the biomass of spinach?
    6·1 answer
  • Which of the following accurately describes fermentation?
    5·2 answers
  • What is osmosis and how does it affect cells 2 examples
    13·2 answers
  • Molecules helped by protein; move insoluble molecules across plasma membrane:
    5·1 answer
  • Which two body systems work together to deliver oxygen through the body?
    12·2 answers
  • The number of different species living in a defined area is known as which of the following?
    10·2 answers
  • When a mycelium infiltrates an unexploited source of dead organic matter, what are most likely to appear within the food source
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!