1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
8

I need some help if you can answer please do thank you.!.!.!

Health
1 answer:
nalin [4]3 years ago
8 0
It helps remove wastes. thus why we pee.
You might be interested in
The nurse is assessing a patient's pulse and notices a difference between the patient's apical pulse and radial pulse. the apica
IceJOKER [234]
13 pulse deficitbjfbbnsins i;mninitttttttttrrrjb rt jwjnj
6 0
4 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
The muscular system includes three types of muscles. Which one of the
Dominik [7]
A. Fibrous. That is not a type of Muscle.
8 0
3 years ago
Read 2 more answers
If a pack of cigarettes cost $6.00, determine the approximate amount of money that would be spent in one month if someone were t
Hatshy [7]
Your answer would be 540$ because 6•3=18 and 18•30 =540
3 0
3 years ago
The water cycle involves water in the liquid, solid, and gaseous states of matter. In which of the following Earth systems can w
Katen [24]

Answer:

D. all of these

3 0
4 years ago
Read 2 more answers
Other questions:
  • A substance needed for the proper functioning of the thyroid gland is
    15·1 answer
  • the nurse instructs a client about kegel exercises to manage urinary stress incontinence. which statement by the client indicate
    5·2 answers
  • PLEASE HELP! Is cocaine generic available? (This is for my health project)
    10·1 answer
  • What are the three treatments of Osteosarcoma ?​
    6·1 answer
  • How can you reduce stress
    9·2 answers
  • Which of these is a significant personal cost associated with the flu?
    5·2 answers
  • . Why is it important to observe both verbal and nonverbal
    9·2 answers
  • The combination of physical, mental/emotional, and social well-being
    12·1 answer
  • Reducing stress about STDs is an
    8·1 answer
  • Quiz: Practicing Abstinence
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!