1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
3 years ago
13

5 L of ideal gas are in a container with a pressure of two ATM. But will be the pressure if we decrease the volume of the contai

ner to 2.5 L?
Chemistry
1 answer:
sweet [91]3 years ago
4 0

Answer:

1

Explanation:

5÷2=2.5 that means it's 2.5 L for every one ATM

You might be interested in
How many atoms make up a diatomic molecule?
zalisa [80]
The prefix 'di' means two. Hence two atoms make up a diatomic molecule.
Hope this helps!
6 0
3 years ago
1. What is the colour of FeSO4.7H20 crystals?How does this colour change upon heating? Give balanced
svet-max [94.6K]
<span>1. What is the colour of FeSO4.7H20 crystals?How does this colour change upon heating?

</span><span>Melanterite or FeSO4.7H20 is green in color
</span>2FeSO4 ---> Fe2O3 + SO2 + SO3<span>

2. a. What are redox reactions?
It </span><span>is a type of chemical </span>reaction<span> that involves a transfer of electrons between two species. 
</span><span>
b.Why is the reaction between MnO2 and HCl a 
redox reaction?
Because there are atoms that are reduced and are oxidized.

c.Identify the substance oxidized and the 
substance reduced in the above reaction.

</span>MnO2<span> + 4 </span>HCl<span> ---> MnCl2 + 2H2O + Cl2
</span>Mn was reduced and Cl was oxidized
5 0
3 years ago
In molecules, energy is stored in?<br> Atoms<br> Electrons<br> The Nucleus<br> Bonds
Nikolay [14]

Answer:

Atoms

Explanation:

Energy, potential energy, is stored in the covalent bonds holding atoms together in the form of molecules. This is often called chemical energy.

4 0
3 years ago
What is the name of SnF2
Inessa [10]

Answer:

Tin (II) Fluoride......

7 0
3 years ago
Identify the following as physical (P) or chemical (C) changes.
Stels [109]

holacomo es tu pregunta nola entiendo

lanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • have you ever been swimming and noticed some areas in the water are colder and other are warmer? why do you think this happens
    10·1 answer
  • Which substance can be decomposed by chemical means?
    14·1 answer
  • 1. Which is not an example of a physical change to a wooden stick?
    12·1 answer
  • Explain what is the process of combustion?
    5·1 answer
  • Water waves are surface waves. The energy of the waves moves
    15·2 answers
  • A helium balloon with an internal pressure of 1.25 atm and a volume of 3.50 L at 25.00 C
    8·1 answer
  • Hi!! please help! i have 20 mins to turn this in!! :))
    9·1 answer
  • PLEASE HELPP!!
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What are the three ways that an object can interact with a static field?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!