1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valina [46]
3 years ago
11

I need help!

Biology
2 answers:
raketka [301]3 years ago
6 0

Answer: You can clean the water pollution by the water bottle activity.

Explanation:

You can do the water bottle filteration. From your house, you should find a large soda bottle or water bottle. YOu layer it with sand and gravel at the bottom. Line the top of the bottle with a coffee filter. This will allow for a natural filtration system.

You can find this on many science experiments websites because it is a common science fair project.

Search tool would be: homemade water filter

Aleks [24]3 years ago
4 0
Rain catcher: paper towel, water jug, and water, strainer, and box use paint for decoration
You might be interested in
Knowing how food choices impact the function and productivity of cells, why do you think it is important to maintain a healthy d
Scilla [17]

Answer:

healthy diet prevents and protects from diseases like obesity, heart disease, diabetes, cancer and stroke. constantly eating junk food can lead to obesity and chronic diseases like cardiovascular disease, type 2 diabetes, non-alcoholic fatty liver disease and some cancers.

Explanation:

3 0
3 years ago
Which type of blood vessel is both strong and elastic?
kiruha [24]
B! dont worry im positive
4 0
3 years ago
Read 2 more answers
Determining the Formality of a Group Discussion
Karo-lina-s [1.5K]

Answer:

b, c and e

Explanation:

7 0
3 years ago
Read 2 more answers
Contrast a plant cell with an animal cell.how can you tell them apart
alisha [4.7K]

a plant cell has a large centralised vacuole containing cell sap and has a cell wall and an animal cell contains centrioles while a plant cell does not. a plant cell contains chloroplast while an animal cell does not
4 0
3 years ago
Read 2 more answers
PLEASE HELP ME
ANEK [815]
C I believe because they are living so they are able to breath
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which term best describes an enzyme<br> A.substrate<br> B.reactant<br> C.catalyst<br> D.product
    5·1 answer
  • Plzz help!!!
    6·2 answers
  • What does dna rna and starch all have in common
    15·1 answer
  • Enzymes are used in which types of cells? plant cells animal cells both of the above neither of the above
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why does active transport require energy?
    5·1 answer
  • 9)
    15·1 answer
  • A) How long will it take for 40.0 grams of Radium-226 (Ra-226) to decay to leave a total of 2.5 grams of Ra-226? Ra-226 has a ha
    7·2 answers
  • Mention different stages of fertilization in plants
    11·1 answer
  • Ethical dilemmas raised by dna technology and knowledge of the human genome include?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!