1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
7

How can a small change to the temperature of ocean water have a big effect on a tropical depression?

Biology
1 answer:
makkiz [27]3 years ago
3 0
Heat waves can be dangerous, causing illnesses such as heat cramps and heat stroke, or even death. Warmer temperatures can also lead to a chain reaction of other changes around the world. That's because increasing air temperature also affects the oceans, weather patterns, snow and ice, and plants and animals.
You might be interested in
Explain how minerals form in diagram c
Tamiku [17]
Where is diagram c??
3 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
El peróxido de hidrógeno se descompone en presencia de la luz
grin007 [14]
<h2>                          ¡Hola Emma!</h2>

Answer:

¡<u>Si</u>!

Explanation:

El peróxido de hidrógeno es inestable y se descompone lentamente en presencia de luz.

<h3>¡Adiós, que tengas un buen día!</h3>
8 0
3 years ago
A university is building a new student center that is one third the distance from the arts center to the
MrMuchimi

Explanation:

A university is building a new student center that is one third the distance from the arts center to the Academic.

6 0
3 years ago
What cells are most likely bacterial cells
spayn [35]
S and U also P, Q, T r
4 0
3 years ago
Other questions:
  • Summarize how small, nonpolar molecules enter and leave the cell (and why).
    9·1 answer
  • The process in late pregnancy when the fetal head begins to decend into pelvis.
    10·1 answer
  • Describe the cause of the attractions between molecules of water
    11·1 answer
  • What reproduction does bacteria have?
    7·1 answer
  • The energy needed to get a reaction started is known as ________________________.
    15·1 answer
  • The process of making new dna molecules is semiconservative. this means that every new dna molecule is composed of
    11·1 answer
  • You are telling your friend that organic molecules are all made up of carbon backbones with hydrogens. She doesn't understand ho
    13·1 answer
  • Sophie visited Carlsbad Caverns with her family during her summer vacation, and she was amazed at the cave’s formations. She lea
    8·1 answer
  • What is the role of the fungus in the food web shown?
    14·1 answer
  • On which continent were fossils of both Glossopteris and Lystrosaurus discovered?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!