The answer is D. The last one.
glucose is a chemical compound made of 6 atoms of carbon 6 atoms of oxygen and 12 atoms of hydrogen.
Answer:
The correct answer is explained below:
Explanation:
- Flooding and intrusion of salt water in the low lying areas can adversely affect human life. This can happen in the following ways:
- Flooding can cause many people to die due to drowning in the flood water.
- Many people lose their habitat and all their belongings due to the entry of water into the settlements having only the ground floors. These people need to rehabilitated to safer regions.
- The saline water percolates through the ground and mixes with the fresh water present in the water table, thereby making them saline and non-consumable.
- People have to face the dearth of food, drinking water, clothes and electricity until rescue operations are sent.
- Increased chance of transmission of water-communicable or water-borne diseases like diarrhoea.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer: Under normal ambient conditions water is less dense as a solid than as a liquid, so ice floats on water. Most materials are more dense as solids.
Explanation: When water freezes, the molecules do not stack into a close-packed structure. They form a relatively open, honeycomb-like arrangement.
