1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
6

By the year 2050, the world’s population is projected to be _______.

Biology
1 answer:
Alex17521 [72]3 years ago
5 0
The world's population is projected to be 9.7 billion by 2050
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
!!!!50 POINTS PLEASE HELP!!!! Evolution is a change in population over time and includes gene pools of that population. How does
loris [4]

Answer:

Biogeographic isolation affects the changes in gene pools that result from which organisms are breeding -is how biogeographic isolation allows for the change of gene pools over ( time )

Explanation:

4 0
3 years ago
What is a short run?
Brilliant_brown [7]
<span>taken or considered over a short time period; short-term.</span>
4 0
3 years ago
Which of these is an example of embodied mind?
MakcuM [25]

Answer:

All of the Above

Explanation:

7 0
3 years ago
Do sharks have bacteria in their stomach that let them digest their food
miss Akunina [59]

Well, i think it's not bacteria, its Hydrochloric Acid. For shakrs ITS REALLY STRONG, i hope this helps or answers your question! :) x

7 0
3 years ago
Read 2 more answers
Other questions:
  • How does the sun effect the plants
    10·2 answers
  • A doctor hypothesizes that a patient's digestive system is not properly secreting digestive enzymes. Which of the following woul
    11·2 answers
  • The cell theory does not apply to: A. Bacteria B. Plants and animals C. Multicellular organisms D. Rocks and soil.
    12·2 answers
  • Which timeline best shows the history of the development of cell theory?
    14·2 answers
  • Examples of asexual reproduction in animals
    6·2 answers
  • What planet is marked by an arrow in the image below?
    5·2 answers
  • Choose three nutrients and explain how a plant may look if it has a deficiency in those nutrients.
    15·1 answer
  • The digastric muscle’s job
    14·1 answer
  • Similarities between vertebrates and invertebrates
    7·1 answer
  • Practice 5: What major feature in DNA makes the organisms look and act differently? Choose the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!