1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
2 years ago
8

More efficient plumbing reduces water pollution by _______. a. using more water b. using less water c. using cleaner water d. us

ing dirty water Please select the best answer from the choices provided
Chemistry
1 answer:
Aliun [14]2 years ago
6 0

Answer:

b. using less water

Explanation:

Pollution can be defined as the physical degradation or contamination of the environment through an emission of harmful, poisonous and toxic chemical substances.

In the United States of America, the agency which was established by US Congress and saddled with the responsibility of overseeing all aspects of pollution, environmental clean up, pesticide use, contamination, and hazardous waste spills is the Environmental Protection Agency (EPA). Also, EPA research solutions, policy development, and enforcement of regulations through the resource Conservation and Recovery Act.

In homes and offices, an effective and efficient design of pipes and other water-related facilities would go a long way to reduce water pollution because the water used are well managed and properly disposed into sinkholes.

Hence, more efficient plumbing reduces water pollution by using less water

You might be interested in
I'll give you a cookie
Llana [10]

Answer:

B. Is the correct answer :) i hope this helps!!

Explanation:

brainliest please?

8 0
3 years ago
Read 2 more answers
Calculate the pH during the titration of 30.00 mL of 0.1000 M HCOOH(aq) with 0.1000 M NaOH(aq) after 29.3 mL of the base have be
pashok25 [27]

Answer:

3.336.

Explanation:

<em>Herein, the no. of millimoles of the acid (HCOOH) is more than that of the base (NaOH).</em>

<em />

So, <em>concentration of excess acid = [(NV)acid - (NV)base]/V total</em> = [(30.0 mL)(0.1 M) - (29.3 mL)(0.1 M)]/(59.3 mL) = <em>1.18 x 10⁻³ M.</em>

<em></em>

<em> For weak acids; [H⁺] = √Ka.C</em> = √(1.8 x 10⁻⁴)(1.18 x 10⁻³ M) = <em>4.61 x 10⁻⁴ M.</em>

∵ pH = - log[H⁺].

<em>∴ pH = - log(4.61 x 10⁻⁴) = 3.336.</em>

7 0
3 years ago
The RNA and DNA backbone differ because the DNA sugar is missing what element?
hammer [34]

Answer:

D.

Explanation:

4 0
2 years ago
The theory of plate tectonics describes the movement of continental plates across the Earth's surface as if they were riding on
emmainna [20.7K]

Answer:

B and E

Explanation:

These two options support the theory of plate tectonics.

3 0
3 years ago
Read 2 more answers
Which type of energy in the bungee cord prevents the bungee jumper from hitting the ground
Effectus [21]
Elastic potential energy
7 0
3 years ago
Other questions:
  • What’s the answer? And if you find the answer in a pdf, comment the link.
    13·1 answer
  • Burning a piece of wood in fire can be best described as a chemical change because the atoms in wood change their state. physica
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Grams needed to prepare the solution
    14·1 answer
  • What is the longest day of the year?
    14·2 answers
  • Help me please do this Question :)
    6·1 answer
  • 3. A property that does NOT depend on the amount of matter such as density, color, temperature. A. Intensive B. Extensive​
    6·1 answer
  • What is melting point of impure ice ​
    11·2 answers
  • The whistle of a teakettle has a greater frequency than a drumbeat. True or false and why
    13·1 answer
  • Science
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!