Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Eukaryotic cells, the theoretical maximum yield of ATP generated per glucose is 36 to 38, depending on how the 2 NADH generated in the cytoplasm during glycolysis enter the mitochondria and whether the resulting yield is 2 or 3 ATP per NADH
Answer: Luster (happy to help)
Explanation: Luster is the property of minerals that indicates how much the surface of a mineral reflects light.
Answer:For Fe
Z=26
Explanation:
1s2 2s2 2p6 3s2 3p6 4s2 3d6
Are there 26 electrons here? Why should there be 26?
So going back to the inert gas, argon ( Z=18 ), we get
[Ar] 4s2 3d6
Make sure to check your work by counting the electrons you have
Answer: Each trial was repeated several times during the experiment.
A scientific design refers to a scientific plan or methodology, which needs to be followed to perform a experiment so as to obtain accurate and appropriate result matching with the situation of the hypothesis. Each trial was repeated several times during the experiment best describes an experiment that had a good scientific design because trials in an experiment brings either concordant or consistent results or inconsistent results. The concordant results suggests that the methodology applied is correct, and inconsistent results show that methodology applied is incorrect.
