The answer to this is false, a vector is a disease usually spread from a bite.
I would say that answer choice C is the best out of this selection. Carbon is the main element in organic compounds, and organic compounds just so happen to make up the cells that carry out life processes for all living things. Hope this helps.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Option C Habitat.... Polar bears are only found in the Arctic. The most important habitats for polar bears are the edges of pack ice where currents and wind interact, forming a continually melting and refreezing matrix of ice patches and leads (open spaces in the ocean between sea ice).
Communicate , experiment , hypothesis, collect data
