1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
3 years ago
12

Can someone help me fill this out i have no idea

Biology
1 answer:
romanna [79]3 years ago
6 0

Answer:

1. Renewable

2. wood

3. Sun ... Wind

4. Water

5. Electricity

Explanation:

You might be interested in
Washing your hands frequently can prevent the spread of many vectors.
ankoles [38]
The answer to this is false, a vector is a disease usually spread from a bite.
8 0
3 years ago
Read 2 more answers
Which of the following statements BEST describes the importance of carbon in the cell
SVEN [57.7K]
I would say that answer choice C is the best out of this selection. Carbon is the main element in organic compounds, and organic compounds just so happen to make up the cells that carry out life processes for all living things. Hope this helps.
5 0
4 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Polar bears live in the arctic. the arctic is their select one:
Vadim26 [7]
Option C Habitat.... Polar bears are only found in the Arctic. The most important habitats for polar bears are the edges of pack ice where currents and wind interact, forming a continually melting and refreezing matrix of ice patches and leads (open spaces in the ocean between sea ice).
8 0
4 years ago
Read 2 more answers
What are 3 ways the scientific community reviews scientific results
ira [324]
Communicate , experiment , hypothesis, collect data
8 0
4 years ago
Other questions:
  • Which has an important role in how species change over time?
    14·1 answer
  • A 27-year-old female presents with a chief complaint of burning and pain on urination. she has no previous history of urinary tr
    15·1 answer
  • How many chromosomes do haploid cells have?
    10·1 answer
  • Which of the following is true for a cell that has a nucleus
    8·1 answer
  • What does the Calvin cycle do
    12·2 answers
  • Which disease is caused indirectly by pollution? ebola cholera influenza aids
    8·1 answer
  • Wild diploid wheat has seven chromosomes in its pollen. Discuss the major events that had to occur for tetraploid pasta wheat to
    7·1 answer
  • In what circumstances seed can be a sink​
    14·2 answers
  • 7. Distinguish among asymmetry, radial symmetry, and bilateral symmetry.
    7·1 answer
  • In contrast to autonomic synapses, the synapses between neurons and skeletal muscle (neuromuscular junctions) ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!