1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
2 years ago
5

Answers are either: 10.4g, 5.18g, 37.3g, 26.4g, 20.7g

Chemistry
1 answer:
gizmo_the_mogwai [7]2 years ago
8 0

Answer:

20.7 g NH3

Explanation:

<u>Convert to moles of N2:</u>

(17.0 g N2) / (28.02 g/mol N2) = 0.607 moles N2

<u>Convert to moles of NH3: </u>

(0.607 moles N2)(2 moles NH3 / 1 mole N2) = 1.213 moles NH3

<u>Convert to grams of NH3:</u>

(1.213 moles NH3)(17.03 g/mol NH3) = 20.66 g NH3

You might be interested in
Which type of energy uses the photoelectric effect?
ikadub [295]

Answer:

My lovely people the answer is SOLAR

Explanation:

i just know

8 0
2 years ago
Can y'all help me with number 4
astraxan [27]
I think the answer is A but i'm not sure
6 0
3 years ago
Read 2 more answers
What is the gasoline doing to our environment?
luda_lava [24]
Gasoline use contributes to air pollution
Gasoline is a toxic and highly flammable liquid. The vapors given off when gasoline evaporates and the substances produced when gasoline is burned (carbon monoxide, nitrogen oxides, particulate matter, and unburned hydrocarbons) contribute to air pollution. Burning gasoline also produces carbon dioxide, a greenhouse gas.
5 0
3 years ago
Which of the following equations has the correct products and is balanced correctly for a reaction between Na3PO4 and KOH?
ASHA 777 [7]

The answer is: A) Na3PO4 + 3KOH → 3NaOH + K3PO4, because K retains the same charge throughout the reaction.

This chemical reaction is double displacement reaction - cations (K⁺ and Na⁺) and anions (PO₄³⁻⁻ and OH⁻) of the two reactants switch places and form two new compounds.  

Na₃PO₄ is sodium phosphate.  

KOH is potassium hydroxide.  

NaOH is sodium hydroxide.  

K₃PO₄ is potassium phosphate.  

According to the mass conservation law, there are same number of atoms on both side of balanced chemical reaction.

5 0
3 years ago
The development of new technology requires the evaluation of the overall benefit to cost ratio of the new technology.
avanturin [10]

Answer:

B and C Reduce Emissions and Least fuel economy

Explanation:

Plug-in electric vehicles are related, fun and practical (also called electric cars or hybrid electric vehicles).  We will reduce emissions and save you even money. EVs deliver more than individual advantages.  EVs will allow the US to have a more diverse range of transportation fuel options.  Last year the US used almost nine billion barrels of oil, of which two-thirds went into shipping.  We are vulnerable to price increases and supply disruptions because of our dependence upon oil. EVs help reduce this threat, as almost all US electricity, including coal, nuclear, natural gas and renewables, is generated from domestic sources.Vehicles can also minimize the CO2 emissions, improve health, and reduce environmental damage that contribute to climate change and smog. Charging your EV for renewable, such as solar or wind, will further reduce these emissions. Link to a calculator on the right to the pollution disparity between the traditional and an EV. Discover how EV reduce pollution and their emissions during their life cycle.

6 0
3 years ago
Other questions:
  • 32 Points!!! Match the definition with correct keyword.
    5·1 answer
  • Theoretically, how many moles of carbonic acid will be produced by 3.00 g sample of NaHCO3?
    13·1 answer
  • The charge of single electron
    5·1 answer
  • How hot Will a 2.3L balloon have to get to expand to a volume of 250L?
    9·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • In a chemical process, three bottles of a standard fluid are emptied into a larger container. A study of the individual bottles
    11·1 answer
  • If carbon lost one proton, what atom would be formed
    12·1 answer
  • When might a plot of ln[a] vs time not yield a straight line?
    7·1 answer
  • What is the mass of 2.90 ×1022 formula units of NaOH (Molar mass = 40.0 g/mol)?
    6·2 answers
  • PLEASE ANSWER QUICKLY ASAP <br>READ QUESTIONS CAREFULLY ​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!