The key enzyme in the regulation of the citric acid cycle is citrate synthase. It functions in the mitochondria.
<h3>Citrate synthase and cellular respiration </h3>
Cellular respiration is a series of reactions that produce ATP by using the energy stores in the chemical bonds of foods.
Cellular respiration is divided into glycolysis, the citric-acid cycle and oxidative phosphorylation.
Citrate synthase is an enzyme found in the mitochondrial matrix, which is involved in the citric acid cycle.
Learn more about cellular respiration here:
brainly.com/question/2809259
A physical change<span> in a substance doesn't </span>change<span> what the substance is. In a </span>chemical change<span> where there is a </span>chemical reaction<span>, a new substance is formed and energy is either given off or absorbed.</span>
On adding salt.....The boiling temperature increases.....
So ∆t= KB * molality
=O.52*(58/58)/4
= O.52*1/4
= 0.13
So increase is 100+.13=100.13°c
The number of energy levels to which an electron can jump depends on the amount of energy the electron possesses. Each energy level has a specific amount of energy an electron needs to have before it can be in there. So, if an electron doesn't have enough energy to be in that energy level then it won't jump to that higher level.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
