1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
5

PLEASE HELP FAST!!!

Biology
2 answers:
QveST [7]3 years ago
3 0

Answer:

4

Explanation:

Mars Odyssey and Mars Express required spectrometric equipment that could analyze Mars's atmosphere

STALIN [3.7K]3 years ago
3 0

Answer:

answers to Video 1 and 2 don't copy word for word

Explanation:

Video 1 questions:

1.Viking 1 and Viking 2 transmitted six years of panoramic views from Mars to Earth, while the pathfinder spent three months transmitting large quantities of Martian environment data. For study, the Viking 1 and 2 probes sent photographs of the Martian landscape back to Earth, while the pathfinder was the first robotic rover to reach the Martian atmosphere directly.  

2.It contributed to the discovery that life on Mars once actually existed because of evidence of water being found underground at the Martian poles.  

3.it helped us to discover that life on Mars once probably existed because of signs of water being found underground at the Martian poles.  

4.Spectrometric equipment that could analyze Mars' atmosphere was needed by Mars Odyssey and Mars Express.  

5.A probe is a spacecraft that flies across space to gain information about science. Probes have no astronauts. Probes submit data back to earth for analysis by scientists. Voyager 2 and many more are one example of a space probe.  

Video 2 questions:

1.Radio waves are a type of electromagnetic radiation that is best recognized for its use in Technologies for contact, such as television, cell phones and radios. Such devices receive radio transmitters In the speaker, waves and transform them to mechanical vibrations to produce sound waves.  

2.A radio telescope is essentially a telescope equipped to receive space-based radio waves.  

3.It has three numerical elements, each of which has one or more antennas to absorb the incoming radio waves. Two is a receiver and amplifier to lift to a detectable level the very weak radio signal. And lastly, a recorder to hold a signal log.  

4. An electromagnetic wave is a radio wave. The speed of light flows with it. In the electromagnetic spectrum, it is the longest wavelength. This is used in RADAR for wireless and radio communication that is obtained by an antenna, and radio waves are also used. RADAR is a method of tracking used to determine object velocity.  

5.Through studying the frequency, power, and timing of radio emissions from these objects, radio telescopes help advance our knowledge of the universe, and astronomers will enhance our understanding of the universe.  

You might be interested in
4 Which statement best describes the graph shown?
sergey [27]

Graph attached

Answer:

b. Less energy is needed to start reaction B.

Explanation:

The graph shows two different reactions and the energy required over time

a. More energy is released by the original reaction.  - this is false, more energy is required for the original reaction to proceed

b. Less energy is needed to start reaction B.  - this is true, the peak of the curve is lower showing less energy is required

c. The original reaction is catalyzed.  - this is false, likely reaction B is catalyzed

d. Reaction B occurs at a slower rate.- false, they occur at the same rate.

3 0
3 years ago
Her immune system is exhibiting the _ line of defense. This defense is part of _ immunity.
lisov135 [29]

last line of defense is the first part.

and the defense is part of her system immunity. this makes sense since the immune system is used to guard against viruses and diseases

4 0
3 years ago
PLZ HELP is oxygen a fluid
konstantin123 [22]
No I am afraid it is not lol
8 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
How many legs does a baby mouse have ease i need help​
BlackZzzverrR [31]

Answer:

Mice have four legs, four feet and one tail per unit-mouse.

3 0
2 years ago
Read 2 more answers
Other questions:
  • Decomposers consume nonliving organic matter. Please select the best answer from the choices provided
    13·2 answers
  • Keiko did an experiment to find out how aspirin affects tissue repair rates in rabbits. Her results indicate that aspirin can he
    11·2 answers
  • Leonard designed a parallel circuit to light two lightbulbs. But his circuit doesn’t work. Which two items in the circuit must b
    11·1 answer
  • A researcher collected archaea and protists from a thermal vent. how do the cells of these two organisms differ?
    5·1 answer
  • When light strikes a transparent material, most of the light is absorbed or reflected. a. true b. false Is it B?
    11·1 answer
  • The actions involved in the process of digestion are
    15·1 answer
  • How did the nervous and endocrine system work
    5·1 answer
  • How does the composition of the object in figure A differ from the objects shown in figure B? Name each object.
    5·1 answer
  • What affect does the properties of water have on Earth's surface and its systems?
    7·2 answers
  • While sitting on a picnic blanket at the park, Sami didn't notice ants swarming around her feet and repeatedly biting her. She b
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!