Answer:
No question so I'm just taking the points
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
This is so basic bro u gotta first move
Answer: If a substance has a boiling point of 
then it is true that it will also change from a gas to a liquid at 78 °C while the gas loses energy.
Explanation:
The temperature at which vapor pressure of a liquid substance becomes equal to the atmospheric pressure is called boiling point of substance.
At the boiling point, liquid phase and vapor phase remains in equilibrium.
This means that as liquid phase changes into vapor phase and also vapor phase changes into liquid phase at the boiling point.
Thus, we can conclude that if a substance has a boiling point of then it is true that it will also change from a gas to a liquid at 78 °C while the gas loses energy.
