1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cupoosta [38]
3 years ago
10

Where is the DNA located in a eukaryotic cell?

Biology
2 answers:
Dimas [21]3 years ago
8 0

Answer:

Nucleus

Explanation:

Edge

V125BC [204]3 years ago
6 0

Answer:

Nucleus

Explanation:

Don’t worry sometimes you forget the most simplest things but you have people to help you so don’t be discoraged

You might be interested in
A family takes its summer vacation at a beach resort. Six-year-old Timmy spends the entire morning in a swimming pool. When his
Kitty [74]

Water diffuses into the skin via sweat ducts which alters the electrolyte balance. electrolytes can be salts like sodium and potassium. This alters the stability of neurons causing blood vessels to constrict therefore decreasing the amount of fluid in the fingers which would normally give the skin tension. The decrease causes wrinkles.
8 0
3 years ago
Complete the Punnett square below by showing the genetic makeup of the parent plats of the cross shown.Be sure to show both gene
aksik [14]

Answer:

The correct answer is -

Parent 1: RW, Parent 2: RR

Explanation:

In the given punnet square there are four offspring and it is a monohybrid cross between parent 1 and parent 2. The four offspring produced in this cross have RR, RR, RW, and RW alleles. By the genotype of the offsprings, it is clear that there are 50 percent pure or true-bred and 50 percent are heterozygous.

Each parent contribute two alleles and these alleles are independently assort in the zygote to form offspring so there must be R, R, R and W allele present in the parent

Parent 2  →       R     R

Parent 1 ↓     R  RR   RR  (one allele (R) come from each parent in zygote)

                    W  RW  RW (one allele  (R and W) come from each parent)

8 0
3 years ago
If you cross a mule and a horse, you get a donkey. How many chromosomes does a donkey have?
madreJ [45]

Answer:

62

Explanation:

31 pairs

A mule is the offspring of a male donkey (a jack) and a female horse (a mare). A horse has 64 chromosomes, and a donkey has 62. The mule ends up with 63. Mules can be either male or female, but, because of the odd number of chromosomes, they can't reproduce.

3 0
3 years ago
Which usually has within it a number of related classes? A. order B. family C. phylum D. species PLEASE HELP
erik [133]
The answer is A) Order
6 0
3 years ago
If a TRNA had a AGC anticodon it could attach a
Contact [7]

A transference RNA (tRNA) is an adapter molecule that decodes a codon messenger RNA (mRNA) during the synthesis of a polypeptide chain. These molecules (tRNAs) play a fundamental role during translation.

  • If a tRNA had an AGC anticodon it could attach a codon having the sequence UCG.

  • During translation, tRNAs act at specific sites in a ribosome to synthesize a polypeptide chain (i.e., a protein) from an mRNA sequence.

  • The anticodon of the tRNA binds by base complementary to a triplet of nucleotides or 'codon' in the messenger RNA (mRNA) during protein synthesis (i.e., translation).

  • According to the base complementarity rules, in RNA, Adenine always pairs with Uracile (Thymine in DNA), whereas Guanine always pairs with Cytosine.

Learn more in:

brainly.com/question/10014731?referrer=searchResults

5 0
2 years ago
Other questions:
  • Describe how fossils help us understand the past
    15·1 answer
  • Multiple alleles _____.
    7·1 answer
  • Explosive volcanic eruption commonly result from?
    14·1 answer
  • list two factors that affect how important a particular greenhouse gas is in contributing to the greenhouse effect
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What causes temperature extremes in the dessert??
    8·2 answers
  • Use the punnett squares below to model each parent combination after filling in each Punnett square predict then percentages of
    12·1 answer
  • Identify the following statements as True or False.
    11·1 answer
  • How were dead S-type cells able to transform living<br> R-type cells?
    8·1 answer
  • Which of the following statements about the Earth’s water is not true?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!