1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
7

What is the scale that measures the acidity or basicity of a solution?

Chemistry
1 answer:
bearhunter [10]3 years ago
3 0

Answer:

PH scale is a universal indicator of strongness of base and acid

You might be interested in
How many calories is 130. joules?
skad [1K]
1 Cal ---------- 4.184 J
? Cal ---------- 130.0 J

130.0 x 1 / 4.184 => 31.07 Cal

hope this helps!


6 0
3 years ago
If an electrostatically charged object is placed near other objects, which of the following will occur? Select all that apply. I
Alja [10]

Answer:

As the electrostatically charged object is to be placed in the field of charged particles it will be attracted to those who would be of oppositely charged and repelled by the same charged particles. phenomenon of like charges repel and opposite charges attract each other will be carried out and no deflection will be shown by the charge towards the neutral charge.

5 0
3 years ago
Read 2 more answers
7. Write the equation for the positron emission of barium-127.
ziro4ka [17]

The reaction is given by

\\ \rm\Rrightarrow {}^{127}_{56}Ba\longrightarrow {}^{0}_{+1}\beta+{}^{127}_{55}Cs

Barium goes underneath beta decay to form Ceaseum

  • Cs is very mellable element
  • It can melt on your hand
8 0
2 years ago
How many molecules are in 1kg of water
Mila [183]

Answer:

334.2× 10²³ molecules

Explanation:

Given data:

Mass of water = 1 Kg ( 1000 g )

Number of molecules = ?

Solution:

Number of moles of water:

Number of moles = mass/ molar mass

Number of moles = 1000 g/ 18 g/mol

Number of moles = 55.5 mol

1 mole contain 6.022× 10²³ molecules

55.5 mol×6.022× 10²³ molecules

334.2× 10²³ molecules

8 0
3 years ago
The gravitational force exerted by an object is given by F = mg, where F is the force in newtons, m is the mass in kilograms, an
Andre45 [30]

The height of the column is 0.457 m and the mass of the atmosphere is calculated as 1.03 × 10 ⁴ kg.

<h3>What is Pascal? </h3>

Pascal is defined as the force per unit area. It expressed in Newton pr square meter of area.

1 Pa = 1 N / m²

Pressure = force / Area

According to the question, the expression of force is as given below

F = mg

where,

F is the force,

m is the mass,

g is equal to the acceleration due to the gravity

Now, the area of the atmosphere is 1 m².The pressure is 1 atm. Pressure in Pascal.

1 atm = 1.01325 × 10 5pa

Therefore, the expression for pascal become as follows.

1.01325 × 10 5 pa = mg /area

1.01325 × 10 5 pa = m × 9.81 m/s² / 1 m²

M = 1.01325 × 10 5 pa × 1 m² / 9.81 m² × 1 Nm -² /1 pa × 1 kg m-² / 1 N

1.03 × 10 ⁴ kg

Given,

The density is 22.6 g /mL , pressure is 1 atm, and area is 1 m²

The relation between density and pressure can be given as follows.

P = hpg… … …(1 )

were , h is the height of the column

p is the density.

Hpg = 1.01325 × 10 5 pa × 1 N/m² /1 pa

H = 1.01325 × 10 5 N/m² / pg × 1 kg ms-² / 1 N

= 1.01325 × 10 5 kg m-¹ s -² / 22.6 g mL -1 × 1 kg/ 10 ³ g × 1 mL / 10 -6 m ³ × 9.81 m s- ²

= 0.457 m

Therefore, the height of the column is 0.457 m.

Thus, we concluded that the height of the column is 0.457 m and the mass of the atmosphere is calculated as 1.03 × 10 ⁴ kg.

learn more about density:

brainly.com/question/952755

#SPJ4

7 0
1 year ago
Other questions:
  • Vanillin is the compound containing carbon, hydrogen, and oxygen that gives vanilla beans their distinctive flavor. The combusti
    14·1 answer
  • Calculate the solubility of carbon dioxide in water at an atmospheric pressure of 0.400 atm (a typical value at high altitude).A
    5·1 answer
  • Elements are placed in the same column of the periodic table because they share the same number of valance electrons. Please sel
    12·2 answers
  • Water , when left uncovered,slowly changes into vapour.what happens to water
    7·1 answer
  • Two teaspoons of salt are added to a glass of water which is then stirred until no more salt grains can be seen. Two more teaspo
    9·2 answers
  • How dose a greenhouse allow plants to be grown in the cold winter months?
    7·2 answers
  • Pleas<br> Help me I need to know
    12·1 answer
  • Select the more electronegative element in each pair.a.Cl or Fb.Se or Oc.N or Asd.Na or Mg
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which type of monomer combines and forms polypeptides?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!