Some evidence on the safety of vaccines.

Biology

2 answers:

tia_tia [17]3 years ago

5 0

Answer:

The safety and effectiveness of vaccines are under constant study. Because vaccines are designed to be given routinely during well-child care visits, they must be extraordinarily safe. Safety testing begins as soon as a new vaccine is contemplated, continues until it is licensed, and is monitored indefinitely after licensure.

Explanation:

STatiana [176]3 years ago

3 0

Answer:

well

Explanation:

Before a vaccine is ever recommended for use, it’s tested in labs. This process can take several years. FDA uses the information from these tests to decide whether to test the vaccine with people.

During a clinical trial, a vaccine is tested on people who volunteer to get vaccinated. Clinical trials usually start with 20 to 100 volunteers, but eventually include thousands of volunteers. These tests can take several years and answer important questions like:

You might be interested in

Why do scientists use models to study changes to the earth’s surface

Stells [14]

Because it’s time consuming and money consuming to observe from space so models are required

6 0

3 years ago

Sound wave vibrations are transmitted by three tiny bones located in the

Sauron [17]

Located in the Middle ear

8 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

The ATP molecule shown consists of a base,__________, and a chain of three phosphates.

kicyunya [14]

ATP consists of an Adenine base, a ribose (sugar), and 3 phosphate groups
Hope this helps

8 0

3 years ago

Read 3 more answers

2. Distinguish between prokaryotic and eukaryotic cells<br> Prokaryotic:<br> Eukaryotic:

marin [14]

Answer:

The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not. ... The nucleus is only one of many membrane-bound organelles in eukaryotes. Prokaryotes, on the other hand, have no membrane-bound organelles.

Explanation:

7 0

3 years ago