1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sveta_85 [38]
3 years ago
10

T/F___ At the eutectic composition, an alloy can solidify at a constant temperature.___ For effective dispersion strengthening,

the dispersed phase should be needle-like, as opposed to round___ Intermetallic compounds are usually hard and brittle.___ For effective dispersion strengthening, the dispersed phase should be continuous.___ Stoichiometric intermetallic compounds exist overa range of compositions.___ Faster solidification results in smaller interlamellar spacing
Chemistry
1 answer:
azamat3 years ago
4 0

Answer:

  • TRUE
  • FALSE
  • TRUE
  • FALSE
  • FALSE
  • TRUE

Explanation:

  • At the eutectic composition, an alloy can solidify at a constant temperature : TRUE . this is because at eutectic composition the type of reaction that takes place there is invariant reaction in its thermal equilibrium
  • For effective dispersion strengthening, the dispersed phase should be needle-like, as opposed to round : FALSE. because the rounded shape will not cause a crack.
  • Intermetallic compounds are usually hard and brittle : TRUE. because Intermetallic compounds prevents dislocation movements and this makes them brittle and hard
  • For the effective dispersion and strengthening, the dispersed phase should be continuous : FALSE. this is because the dispersed precipitate must be small and not continuous
  • Stoichiometric intermetallic compounds exist over a range of compositions : FALSE
  • Faster solidification results in smaller interlamellar spacing : TRUE
You might be interested in
Determine the atomic number, atomic mass and element name of the following:
laiz [17]

Answer:

Carbon-14

Carbon-14: with 6 protons and 8 neutrons, and an atomic mass of 14.

3 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
How does concentration affect boiling point of a solvent?
nalin [4]

Answer / explanation:

How does concentration affect boiling point of a solvent?

The amount by which the boiling point is raised is directly dependent on the concentration of the solute.

The higher the concentration of a solute, the more it is said to be difficult for the solvent molecules to escape into the gas phase.

However, when a non volatile amount of substance is dissolved in a given solvent, the boiling point of the given solvent increases.

The higher the concentration, the more higher the boiling point of a solvent.

It requires a higher temperature for enough solvent molecules to escape , this the boiling point is raised elevatedly

5 0
3 years ago
URGENT HELP PLEASE balance equation !20 points!
yKpoI14uk [10]
Au^2S^3+ 3H^2 = 2Au + 3H^2S
5 0
3 years ago
The ability to attract an electron for bonding is called:
Darina [25.2K]
The ability to attract an electron for bonding is called (option B) Electronegativity.
4 0
3 years ago
Other questions:
  • what is the molecular formula for a compound, having a empirical formula of CH20 and a molar mass of 150 g/mol
    12·1 answer
  • Calculate the specific heat capacity of a piece of ice if 1.30 kg of the wood absorbs 6.75×104 joules of heat, and its temperatu
    11·2 answers
  • Which question cannot be explained by chemistry?
    13·2 answers
  • Why is a ylid a stable nucleophile? Select all that apply. Group of answer choices The proximity of the positively charged phosp
    6·1 answer
  • How many oxygen atoms are in the Perth products of the balanced reaction below
    15·1 answer
  • Name two kinds of rocks formed by conduction of energy.
    7·1 answer
  • What is the source of almost all energy on earth
    6·2 answers
  • How many grams of Na2SO4 are required to make 0.30 L of 0.500 M Na2SO4?
    14·1 answer
  • Please help as soon as possible
    14·2 answers
  • What are some instantaneous speed examples in an everday life!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!