1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timurjin [86]
3 years ago
6

1. Describe the relationships between the

Biology
1 answer:
Anettt [7]3 years ago
7 0
In multicellular organisms individual cells grow and then divide via a process called mitosis, thereby allowing the organism to grow. Cellular division and differentiation produce and maintain a complex organism, composed of systems of tissues and organs that work together to meet the needs of the whole organism.
You might be interested in
During radiatoin what is the most dangerous risk of the treatment
kaheart [24]
The rays can get to your skin causing skin cancer or some other disease I think.

Hope this helps... mark as Brainliest plz
7 0
3 years ago
A protein helps transport a neutral substance from a region of higher concentration to a region of lower concentration. The tran
LuckyWell [14K]

Answer: The correct answer is option C

FACILITATED DIFFUSION.

Explanation: FACILITATED DIFFUSION is a form of passive transport,it is the process by which substances(molecules) move from a region of higher concentration to a region if lower concentration along their concentration gradient through the help of a membrane transporter forming a pore or channel(Protein).

Facilitated diffusion dies not require high energy to occur since a concentration gradient is involved.

3 0
3 years ago
Read 2 more answers
What would happen if we didnt have mitochondria ? ( paragraph)
slamgirl [31]
Basically, the cell wouldn't be able to "breathe," as the mitochondria is where the respiratory functions of the cell happens. No energy would be produced, and then the cell would stop moving and die.
6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Is species singular or plural?
WINSTONCH [101]
Both. You can use it as singular or plural.
5 0
4 years ago
Other questions:
  • Spermatogenesis produces __________________ from one original cell.
    6·2 answers
  • most matter in the natural world is a mixture of substances. Consider seawater, dirt, and plants. Explain why each of these exam
    6·2 answers
  • Jason’s team studied the________ , which measures incoming solar radiation and outgoing terrestrial infrared radiation.
    5·2 answers
  • Which animals like sunny weather?
    13·2 answers
  • Which of the following statements is true?A. An isolated system cannot exchange either matter or energy with its surroundings. B
    10·1 answer
  • Why are salt and sugar used in the production of dried meat and dried fruits?
    14·1 answer
  • Which of the following statement is correct about about the hierarchy of the taxonomic system currently used to classify organis
    5·1 answer
  • How many lights were used...
    15·2 answers
  • The dermal layer is blank layer of the plant
    14·2 answers
  • I NEEEEDDDDD HELP PLEASE
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!