1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
11

Andrea divided a group of a species of insect she found in her backyard into two groups based on antenna size. The insects with

short antennae produced offspring with short antennae. The insects with long antennae produced offspring with long antennae and short antennae. Which of the following statements is most likely true?
A
The gene for short antennae is recessive and the gene for long antennae is dominant.

B
Length of antennae is random.

C
The gene for short antennae is dominant and the gene for long antennae is recessive.

D
Length of antennae is not a hereditary characteristic.
Biology
1 answer:
Alexxx [7]3 years ago
4 0

Answer:

......mm..............

You might be interested in
A flat sheet of connective tissue that extends beyond the muscle fibers to attach the muscle to bone is a(n) ______. a flat shee
luda_lava [24]

Answer:

A flat sheet of connective tissue that extends beyond the muscle fibers to attach the muscle to bone is a TENDON.

Explanation:

Tendon can be described as a fibrous connective tissue which functions mainly to attach muscles to bones hence, playing a major role in the movement of the bone or structure. Tendons also function to connect muscles to other structures like the eye ball.

Contrary to the tendons, ligaments are also fibrous connective tissues which are involved in the attachment of bone to bone. Hence, ligaments play major role in holding the structures and keeping them stable.

3 0
3 years ago
A cat waiting by its bowl each morning for you to feed it is an example of an)_______ response to an _____ stimulus.
puteri [66]
I think A is the answer it makes the most sense to me
6 0
3 years ago
A segment of mRNA has the sequence UGACAUAGC. Which of the following would represent the
Effectus [21]

Answer:

B

Explanation:

U(uracil) pairs with A(adenine), G(guanine) pairs with C(cytosine)

7 0
3 years ago
Evidence of a chemical change can be observed when-
xeze [42]

Answer:

A. a solid melts into a liquid

Explanation:

4 0
3 years ago
In what way does translation change information?
djverab [1.8K]

According to the research, translation changes the information of the RNA read to form a polypeptide chain, which is a protein with a linear structure.

<h3>What is translation?</h3>

It is the process by which, from the reading of the genetic code in the mRNA, a protein is created.

It occurs in all living beings and takes place in the cytoplasm, where the ribosomes are found, which play a fundamental role in the process.

Therefore, we can conclude that according to the research, translation changes the information of the RNA read to form a polypeptide chain, which is a protein with a linear structure.

Learn more about translation here: brainly.com/question/21757337

#SPJ1

4 0
2 years ago
Other questions:
  • In the Miller-Urey experiment, electrical sparks were passed through a mixture of gases, including hydrogen, water vapor, methan
    15·1 answer
  • What is the substance in tobacco products that causes stained teeth and skin?
    12·2 answers
  • Which of the following factors contributes to the distribution of biodiversity on Earth?
    15·2 answers
  • Which of the following structures collects the depolarization wave from the atria to pass it onto the ventricles?
    5·1 answer
  • What makes aftershocks so problematic
    9·1 answer
  • To ensure contamination from utensils and preparation equipment is eliminated
    12·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Students in a biology class conduct an experiment to determine the effect of temperature on the rate of photosynthesis in a plan
    5·1 answer
  • In the cells of most organisms, genetic information is contained in the:
    13·1 answer
  • ? Help please would appreciate it
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!