1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitrij [34]
2 years ago
7

A container of oxygen with a volume of 60 L is heated from 300 K to 400 k, What is the new volume?

Chemistry
1 answer:
Lunna [17]2 years ago
7 0

Answer:

80L

Explanation:

V1/T1 = V2/T2

V2 = V1 T2/T1

T1 = 300K

V1 = 60L

T2 = 400K

V2 = ?

V2 = V1 T2/T1

V2 = (60L)(400K) / (300K)

V2 = 80L

You might be interested in
Explain what would happen if an electron and a proton were brought near each other and then released. why would this happen?
Leni [432]
They would repel one another because they they have opposing charges
3 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
True or False: the force of attraction that holds two atoms together is called a chemical bond
Genrish500 [490]
The answer is true.
5 0
3 years ago
A nuclear power plant operates at 40.0% efficiency with a continuous production of 1042 MW of usable power in 1.00 year and cons
Sergio039 [100]

Answer:

3.00 x 10^-11 joules / atom of U-235

Explanation:

We know that the formula for Power = Work done (w)/Time (t)

We need to get the joules from power , since Joules is the SI unit of work.

From the formula P = W/t

W = Power (P) * Time (t)

The SI unit for Time is seconds, hence we change 1 year in seconds

1yr * 365 days/yr * 24hrs/day * 60mins/hr * 60 secs/min = 31536000 secs

It was stated in the question that the plant operates at an efficiency of 40%,

Thus to get the true power we divide the power provided in the question by 0.4 or 40%

= X(0.4) = 1042MW

True Power X = 1042/0.4 = 2605MW

Thus true power = 2605 * 10^6 Watts

Now we have the time in seconds and true power in Watts, we then find the work done.

From our above formula P = W/t

W = P*t = (2605* 10^6) (31536000) =

Finally, we can solve for our energy (work):

P = W / T        PT = W = (2880x10^6) (31536000) = 8.22 x 10^16 joules

We then calculate the amount of energy released by only 1 single uranium-235 atom.

= 8.22 x 10^16 joules / 1.07x10^6 g U-235 (235 g / 1 mol)(1 mol/6.0210^23 atoms)

= 3.00 x 10^-11 joules / atom of U-235

5 0
3 years ago
A sample of gas occupies 10.0 L at 240°C under a pressure of
NISA [10]

Answer: 1090°C

Explanation: According to combined gas laws

(P1 × V1) ÷ T1 = (P2 × V2) ÷ T2

where P1 = initial pressure of gas = 80.0 kPa

V1 = initial volume of gas = 10.0 L

T1 = initial temperature of gas = 240 °C = (240 + 273) K = 513 K

P2 = final pressure of gas = 107 kPa

V2 = final volume of gas = 20.0 L

T2 = final temperature of gas

Substituting the values,

(80.0 kPa × 10.0 L) ÷ (513 K) = (107 kPa × 20.0 L) ÷ T2

T2 = 513 K × (107 kPa ÷80.0 kPa) × (20.0 L ÷ 10.0 L)

T2 = 513 K × (1.3375) × (2)

T2 = 1372.275 K

T2 = (1372.275 - 273) °C

T2 = 1099 °C

8 0
3 years ago
Read 2 more answers
Other questions:
  • The carbohydrates seen here contains 3 common elements.They are....
    11·2 answers
  • The Aurora Borealis or northern light occur when solar flares react with the atmosphere near the north poles. The Aurora give of
    15·2 answers
  • Hich of the following statements is true about what happens during a chemical reaction?
    14·1 answer
  • Under certain conditions the solid and liquid states of water can exist in equilibrium how are these conditions indicated on the
    10·2 answers
  • An empty plastic bottle is sealed in a cool room and then moved to a very hot room. What can best be stated about the air pressu
    6·2 answers
  • What is te name of P2CL7
    14·1 answer
  • I need help with chemical formulas<br>​
    14·1 answer
  • Science quiz, i think its chem... grade 8
    14·2 answers
  • Which two types of cells are involved in fertilization?
    10·1 answer
  • Where are taste buds located?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!