Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<em>Answer:</em>
<em>It is the uppermost layer of the three layers of the skin. Summarily, the epithelium is a more general concept, and epidermis is the one type of epithelium, which is a more limited word indicating exterior part of the skin.</em>
<em />
<em>Explanation:</em>
<em>*Hope this helps*</em>
<em />
The earth's surface features are constantly changing in a process known as weathering and erosion. Weathering would happen when rocks would break physically like frost shattering while erosion happens when sediments and rocks are moved from one place to another by agents like water, gravity, wind and ice. These two occurrences are the cause of the constant change of the Earth's surface.<span />
Answer: True
Explanation:
<u>A cell membrane consists of a lipid bilayer made of polar phosphate head and a nonpolar lipid tail.</u> It is semipermeable and regulates the transport of materials through it. For this,<u> it is selectively permeable</u> and since it is made of lipids, hydrophobic and small polar molecules can diffuse easily through it by simple diffusion and down their concentration gradient. However, polar molecules, large molecules (such as glucose) and ions are not able to pass through it because they are repelled.
To accomplish the transport of these molecules that can not diffuse, proteins embebbed in the membrane function as carriers that enable the transport of polar molecules, large molecules and ions by passive (through facilitated diffusion, down its concentration gradient) or active transport (movement against its concentration gradient).
Answer:
I think true statement is A.
