Physician recommends radiation therapy because radiation therapy helps in preventing cellular growth. It uses high-energy radiation to shrink tumor or kill cancer cells. It may be used to cure or to control malignancy when the tumor can no longer be removed or when lymph node involvement is present; also, it can be used prophylactically to prevent spread. Radiation therapy kills cancer cells by damaging their DNA which is the molecules inside cells that carry genetic information and pass it from generation to generation. Radiation therapy can either damage DNA directly or create charged particles within the cells that can in turn damage the DNA. Cancer cells whose DNA is damaged beyond repair stop dividing or die and when these cells die, they are eliminated by the body through natural process.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Uptake of water and nutrients
Explanation:
Found it on quizlet, hope this helps.
They answer is C because echinodermata and cnidaria are examples of radial symmetry
