Metal conductivity generally goes down or resistivity goes up with temperature goes up.
The equation Eºcell = 0.0592/n logK must be used to find n and also Eºcell
2 Al(s) + 3 Mg2+(aq) → 2 Al3+(aq) + 3 Mg(s) Al3+ +3e- --> Al Eº = -1.66 V Mg2+ +2e- -->Mg Eº = -2.37V
To balance the equation, 6 moles of electrons must be transferred (2 Al and 3 Mg). This will be the value of n in the equation.
To find Eºcell, you need the reduction potentials which should be given in a table, and given above. Eºcell = -1.66 - (-2.37) = 0.71 V log K = Eºcell x n/0.0592 = 0.71 x 6/0.0592 log K = 71.95 K = 10^71.95 K = 1.1x10^72
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
It is definitely not A. B is an effect. I would say C because D is more of a conservative answer , C is more of a liberal answer, and we currently live in a liberally swayed world. They are probably looking for C. It is not in your nature to be bad.
The question is cut off in the picture
