Help mee pleasee its urgent .. thank uuuu<3

What role does chlorophyll play in photosynthesis?

Elina [12.6K]

Chlorophyll captures the sun's energy and is used as energy to complete the photosynthesis process

4 0

3 years ago

What is the name for this molecule? a skeletal model of an 8-carbon zig zag chain. there is a double bond between the first and

yKpoI14uk [10]

The name of the compound by using the IUPAC nomenclature of organic compounds is 1 -octene. The correct option is the last option - 1-octene.

<h3>Nomenclature of Organic compounds</h3>

From the question, we are to determine the name of the given molecule.

To name the compound, we will follow the IUPAC rules.

Some of IUPAC rules are

Find the longest continuous carbon chain. Determine the root name for this parent chain.
For Alkenes (organic compounds with double bond), number the chain of carbons that includes the C=C so that the C=C has the lower position number. Change “ane” to “ene” and assign a position number to the first carbon of the C=C.

The given compound has 8 carbons and a double bond. The root name of the compound is octane.

By IUPAC rules, the compound is an Octene.

Since the double bond is between carbon-1 and carbon-2. The compound becomes 1-octene.

Hence, the name of the compound by using the IUPAC nomenclature of organic compounds is 1 -octene. The correct option is the last option - 1-octene.

Learn more on Nomenclature of Organic compounds here: brainly.com/question/26754333

The diagram for the compound is attached below.

8 0

2 years ago

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago

In science test are sometime clled

natita [175]

Answer:

In the scientific method, an experiment is an empirical procedure that arbitrates competing models or hypotheses. Researchers also use experimentation to test existing theories or new hypotheses to support or disprove them

Explanation:

Hope this helps

4 0

3 years ago

Read 2 more answers

What is the correct formula for combining Mg2+ and Br1+

True [87]

Answer: The correct formula is $MgBr_2$

Explanation:

For formation of a neutral ionic compound, the charges on cation and anion must be balanced. The cation is formed by loss of electrons by metals and anions are formed by gain of electrons by non metals.

Here magnesium is having an oxidation state of +2 called as $Mg^{2+}$ cation and bromine $Br^{-}$ is an anion with oxidation state of -1. Thus they combine and their oxidation states are exchanged and written in simplest whole number ratios to give neutral $MgBr_2$ .

The cations and anions being oppositely charged attract each other through strong coloumbic forces and form an ionic bond.

6 0

2 years ago