1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
3 years ago
12

Convert 0.0009 Mm to millimeters.

Chemistry
1 answer:
Cloud [144]3 years ago
7 0

Answer:

0.0009 Meters =

0.9 Millimeters

You might be interested in
What is the reactant that runs out first in a reaction called?
miv72 [106K]

Answer:

limiting reactant

3 0
3 years ago
Use the data, the periodic table, and the station resources to complete the data table and answer the questions below.
lora16 [44]

whats is the question

3 0
3 years ago
AACGTACGATCGATGCACATGCATGGCTACGC
Pachacha [2.7K]

Explanation:

if u have biology A=T and G=C

id.k what ur question is supposed to mean..

7 0
3 years ago
Read 2 more answers
What is the frequency of a photon that has a wavelength of 754 um?​
Bogdan [553]

Answer:

0.39760273

Explanation:

I typed into calculator hope it's right.

6 0
3 years ago
What are the similarities between nucleotides?
Nonamiya [84]

Nucleotides are organic molecules consisting of a nucleoside and a phosphate.

They serve as monomeric units of the nucleic acid polymers – deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both of which are essential biomolecules within all life-forms on Earth. Nucleotides are obtained in the diet and are also synthesized from common nutrients by the liver.

Nucleotides are composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine.

Nucleotides also play a central role in metabolism at a fundamental, cellular level. They provide chemical energy—in the form of the nucleoside triphosphates, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP) and uridine triphosphate (UTP)—throughout the cell for the many cellular functions that demand energy, including: amino acid, protein and cell membrane synthesis, moving the cell and cell parts (both internally and intercellularly), cell division, etc.

Learn more about nucleoside at:

brainly.com/question/28482667

#SPJ4

6 0
1 year ago
Other questions:
  • Which of the following happens during an endothermic chemical change? (5 points)
    10·1 answer
  • List at least three chemical innovations that improve or change your everyday life
    12·1 answer
  • Malleability and ductility and characteristic of substances with
    14·1 answer
  • Select the correct answer.
    5·1 answer
  • A powder contains FeSO4 · 7 H2O (molar mass = 278.01 g/mol), among other components. A 3.055 g sample of the powder was dissolve
    5·1 answer
  • Every force has both _____ and ______.
    12·1 answer
  • Molecule- Mass Conversions<br> 1. How many molecules are there in 23.4 grams of magnesium?
    11·1 answer
  • HELPPPPPPPPP………………….
    6·2 answers
  • An isotope of hydrogen commonly referred to as heavy water is​
    9·1 answer
  • 8) (When allyl alcohol dissolves in water, the particles of allyl alcohol
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!