1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
2 years ago
12

What is a meteorite?

Biology
2 answers:
Alex17521 [72]2 years ago
8 0
It a comet that streaks through earth atmosphere. Cause more than 90 percent of meteorites are of rock, while the reminder consist wholly or partly of iron and nickel
OverLord2011 [107]2 years ago
3 0

Answer:

a celestial object that similar to an asteroid, but a little smaller

Explanation:

You might be interested in
What is the difference between a phytoalexin and a phytoanticipant explained
Ivahew [28]

Explanation:

Phytoanticipins are defined as defense compounds which are constitutively present, i.e., regardless of the presence of pests or diseases.

3 0
3 years ago
Choose the correct word to complete the sentences to explain the classification of organisms. In the mid-eighteenth century, Car
Ostrovityanka [42]

Answer:

3 and 6

Explanation:

3 0
3 years ago
Read 2 more answers
Under what environmental conditions would a zygote not undergo meiosis
sashaice [31]

A zygote will not undergo meiosis in an environmental state that is not favorable for the zygote’s survival i.e. the chance of the zygote to survive is not certain. Take for example, chlamydomonas will form a zygote under normal asexual mitotic reproduction in a favorable environmental condition. However, under unfavorable environmental conditions the organism also reproduce sexually to form a zygote but will never proceed to meiotic division because of the unfavorable environmental state.

8 0
3 years ago
What’s the difference between a theory and a law?
Kitty [74]

A theory is a hypothesis that someone had but has not proven it.

A law is something that is proved.

Example: Sir Issac Newton had a theory on gravity he sat under a tree and then had a conclusion.

4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Compare hydrolysis carbonation and oxidation
    8·1 answer
  • Why might the cell theory actually be a law?
    5·1 answer
  • Wich class of compounds does ammonia belong
    14·1 answer
  • Suppose you are part of a community with a sustainable yield of fish. Which ofthe following would be true?a. The yield of fish i
    11·1 answer
  • Considers thoughts, desires, and motives
    15·1 answer
  • Idk the answer! I’ll mark brainliest whoever puts in answer within 10 minutes!!
    13·1 answer
  • How is atmospheric nitrogen converted into a biologically useful form of nitrogen?
    12·1 answer
  • Help! 2 questions! will mark brainliest! 50 points! pleaseeee due today!! ASAP!!
    9·1 answer
  • What part of the rotifer is responsible for crushing food?
    7·1 answer
  • A what are the events of a stars life in order
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!