1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
4 years ago
15

Butane reacts with oxygen to produce carbon dioxide and water

Chemistry
1 answer:
Wittaler [7]4 years ago
4 0
What exactly are you looking for?
This is the balanced equation.
<span>2 C4H10g + 13 O2g ---> 8 CO2g + 10 H2Og</span>
You might be interested in
Why do all atoms of an element have the same atomic number, although they may have
Evgesh-ka [11]

Answer:

Here’s what I get.

Explanation:

  • The atomic number is the number of protons in the nucleus of an atom.
  • The number of protons determines the number of electrons.
  • The number of electrons determines the chemical properties of the element,

Thus, the atomic number determines the identity of the element.

The atomic mass does not affect the chemical properties, so different isotopes of an element behave alike.

5 0
3 years ago
Identify and describe the appearance of the type of muscle tissue found in your heart
Masja [62]
Cardiac muscles are found only in the heart and are also striated. Smooth muscles ... Identify and describe the appearance of the type of muscle tissue found in your heart<span>.</span>
4 0
3 years ago
Help pleaseee
marissa [1.9K]

Answer:

In order to find the molecular formula from an empirical formula you must find the ratio of their molecular masses.

We know that the molecular mass of the molecule is 70

gmol-1

. We can calculate the molar mass of

CH2

from the periodic table:

C=12.01

gmol−1

H=1.01

gmol−1

CH2 =14.03

gmol−1

Hence we can find the ratio:

14.03

70

≈

0.2

6 0
3 years ago
Which prefix indicates a molecule with 2 carbon atoms?
aleksandrvk [35]
The answer is A. Eth-
7 0
3 years ago
What element behaves MOST like magnesium <br> between Si, S, Sr, Sn
frosja888 [35]

<u><em>Answer</em></u>

  • Sr

<u><em>Explanation</em></u>

  • In periodic table, the elements have almost same properties are present in the same group. As Mg and Sr are present in group II-A, so both behave most likely to each other due to having same valence shell electrons as well.
  • Si and Sn are present in group IV-A which have same behavior but different one from Mg due to different groups.
  • S is present in group VI-A which show different properties from all others one especially from Mg.
6 0
3 years ago
Read 2 more answers
Other questions:
  • How do water go to the sky?
    9·2 answers
  • Camphor, a saturated monoketone from the Asian camphor tree, is used among other things as a moth repellent and as a constituent
    9·1 answer
  • At a constant pressure and amount of gas, how are temperature and volume related?
    13·1 answer
  • Which statement correctly compares sound and earthquake waves?
    7·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Pure potassium hydrogen phthalate is used for the standardization of the sodium hydroxide solution. Suppose that the potassium h
    6·1 answer
  • An alternative form or version of a gene is a(n):
    15·1 answer
  • While both comets and asteroids are found to orbit the sun in our solar system which system which choice correctly explain how t
    9·1 answer
  • Which one is fossil fuel <br>1 fire wood <br>2 coal <br>3 bio-gas<br>4 fire cakes​
    13·1 answer
  • 9. The times of first sprinkler activation (in seconds) for a series of tests of fire-prevention sprinkler systems that use aque
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!