1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
12

The energy of an electron in a multielectron atom is determined by

Chemistry
1 answer:
Wewaii [24]3 years ago
5 0

Answer:

by principal quantum number (n) and azimuthal quantum number (l)

Explanation:

I used the web to answer so I'm not sure if this is right

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
HELP!!! WRITE THE CORRECT ISOTOPE NOTATION FOR EACH OF THE FOLLOW:
kakasveta [241]
The answer is 4 an atom
4 0
3 years ago
What mass of calcium carbonate (in grams) can be dissolved by 4.0 g of hcl? (hint: begin by writing a balanced equation for the
stiks02 [169]
The reaction between calcium carbonate and hydrochloric acid can be expressed through the chemical reaction,

    CaCO3 + 2HCl --> CaCl2 + H2O + CO2

The molecular weight of calcium carbonate is 100 g/mol while that of hydrochloric acid is 36.45. The equation above depicts that 100 g of calcium carbonate can be dissolved in 72.9 g of hydrochloric acid. 

    x = (4 g HCl)(100 g CaCO3 / 72.9 HCl)
      x = 5.49 g

Answer: 5.49 g
8 0
4 years ago
Read 2 more answers
A) Compute the repeat unit molecular weight of polystyrene. B) Compute the number-average molecular weight for a polystyrene for
Andrej [43]

Answer:

Explanation:

In Polystrene, the molecular formula for the repeat unit = C_8H_8;

and the atomic weights of Carbon C = 12.01 g/mol

For Hydrogen, it is 1.01 g/mol

Hence, the repeat unit molecular weight is:

m = 8 (12.01 g/mol)+8(1.01 g/mol)

m = 96.08 g/mol + 8.08 g/mol

m = 104.16 g/mol

The degree of polymerization = no-average molecular weight/repeat unit molecular weight.

Mathematically;

DP = \dfrac{\overline M_n}{m}

\overline M_n= DP \times m

\overline M_n= 25000 \times 104.16 \ g/mol

\overline M_n= 2604000  \ g/mol

7 0
3 years ago
10 points
djyliett [7]
Since the question is incomplete, the table has been searched in order to comply with the question.

Based on the table that I have provided, the order of increasing depth from shallowest to deepest are the following; A,B,C,D,E. The reason that this is the order to be chosen because the one responsible for making water dense is the salt that is on the water and by that, the base is likely to sink whereas the ones with less salt won’t be as thick compared those who have much salt and will skim on its top.

7 0
3 years ago
Other questions:
  • During the lab, you measured the pH of common household items. Write net Brønsted equations that show the acidic or basic nature
    11·1 answer
  • The [α] of pure quinine, an antimalarial drug, is −165. If a solution contains 86% quinine and 14% of its enantiomer (ee = 72%),
    12·1 answer
  • When 8.5 g of methane (ch4) is burned in a bomb calorimeter (heat capacity = 2.677 × 103 j/°c), the temperature rises from 24.00
    7·2 answers
  • Give the ΔH value for the combustion of butane as shown in the reaction 2C4H10(g)+13O2(g)→8CO2(g)+10H2O(g)+5315 kJ.
    13·2 answers
  • A uranium atom has 92 protons in it nucleus use what you know about atoms to predict how many electrons a neutral uranium atom h
    8·1 answer
  • I NEED HELP ASAP!! What is the difference between the experimental group and a control group?​
    7·1 answer
  • 5. Organisms that make their own energy storage molecules are called producers. What process do
    15·1 answer
  • Helpp me Guys I Need This Now:)​
    5·1 answer
  • Red giant stars defination​
    13·2 answers
  • What are the names of the elements symbolized by Ba , Na , and Fe , respectively? Spelling counts!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!