1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
2 years ago
5

Which expression is equivalent to |8| + |-7|?

Mathematics
2 answers:
mrs_skeptik [129]2 years ago
8 0
The answer is 15

explained: since the absolute value of 8 is 8 and the absolute value of -7 is 7, that means the expression is now 8+7 which gives you 15
enot [183]2 years ago
4 0

Answer: The answer would be 15

Step-by-step explanation:

Hope this helps.

You might be interested in
Solve the system using the elimination method.
spayn [35]

Answer:

  (x, y, z) = (-22/13, 29/13, 6/13)

Step-by-step explanation:

Adding the first and second equations, we get ...

  (3x +2y -3z) +(7x -2y +5z) = (-2) +(-14)

  10x +2z = -16 . . . . collect terms

  5x + z = -8 . . . . . . divide by 2 . . . [eq4]

Adding twice the second equation to the third, we get ...

  2(7x -2y +5z) +(2x +4y +z) = 2(-14) +(6)

  16x +11z = -22 . . . . . . [eq5]

Now, we have two equations with the variable y eliminated. We can subtract [eq5] from 11 times [eq4] to eliminate z:

  11(5x +z) -(16x +11z) = 11(-8) -(-22)

  39x = -66

  x = -66/39 = -22/13

From [eq4], we can find z as ...

  z = -8 -5x = -8 -5(-22/13) = 6/13

And from the second equation, we get ...

  y = (1/2)(7x +5z +14) = (1/2)(7(-22/13) +5(6/13) +14) = 29/13

The solution is (x, y, z) = (-22/13, 29/13, 6/13).

6 0
3 years ago
Write an equation in slope-intercept form for the line that passes through the point  ( -1 , -2 )  and is perpendicular to the l
mamaluj [8]

The equation in slope-intercept form for the line that passes through the point  ( -1 , -2 )  and is perpendicular to the line − 4 x − 3 y  =  − 5 is y = \frac{3}{4}x - \frac{5}{4}

<em><u>Solution:</u></em>

<em><u>The slope intercept form is given as:</u></em>

y = mx + c ----- eqn 1

Where "m" is the slope of line and "c" is the y - intercept

Given that the line that passes through the point  ( -1 , -2 )  and is perpendicular to the line − 4 x − 3 y  =  − 5

Given line is perpendicular to  − 4 x − 3 y  =  − 5

− 4 x − 3 y  =  − 5

-3y = 4x - 5

3y = -4x + 5

y = \frac{-4x}{3} + \frac{5}{3}

On comparing the above equation with eqn 1, we get,

m = \frac{-4}{3}

We know that product of slope of a line and slope of line perpendicular to it is -1

\frac{-4}{3} \times \text{ slope of line perpendicular to it}= -1\\\\\text{ slope of line perpendicular to it} = \frac{3}{4}

Given point is (-1, -2)

Now we have to find the equation of line passing through (-1, -2) with slope m = \frac{3}{4}

Substitute (x, y) = (-1, -2) and m = 3/4 in eqn 1

-2 = \frac{3}{4}(-1) + c\\\\-2 = \frac{-3}{4} + c\\\\c = - 2 + \frac{3}{4}\\\\c = \frac{-5}{4}

\text{ substitute } c = \frac{-5}{4} \text{ and } m = \frac{3}{4} \text{ in eqn 1}

y = \frac{3}{4} \times x + \frac{-5}{4}\\\\y = \frac{3}{4}x - \frac{5}{4}

Thus the required equation of line is found

8 0
3 years ago
A plane flying overhead at night is located by two
Gemiola [76]

Answer:

Step-by-step explanation:

B

2

3

​

​

Let the distance of two consecutive stones are x, x+1.

In ΔBCD, we have

tan60

o

=

x

h

​

⇒x=

3

​

h

​

      .....(i)

In ΔABC, we have

tan30

o

=

x+1

h

​

⇒

3

​

1

​

=

x+1

h

​

⇒

3

​

h

​

+1=

3

​

h       ......[from equation (i)]

⇒

3

​

2h

​

=1

⇒h=

2

3

​

​

 km

solution

6 0
3 years ago
A man earned x pesos in 10 days and spent y pesos during each of those days. Write an expression to determine how many pesos he
Vsevolod [243]

Answer:  \dfrac{x}{10}-y

Step-by-step explanation:

Given : A man earned x pesos in 10 days and spent y pesos during each of those days.

i.e. Total earning in 10 days = x

Earning per day =\dfrac{x}{10}    [By unitary method]    (1)

Money spent per day =y      (2)

We know that

\text{Savings = Money earned - Money spent}

i.e. Subtract (2) from (1), we get

\text{Savings = }\dfrac{x}{10}-y

Hence, the expression to determine how many pesos he saved per day will be:-

\dfrac{x}{10}-y

3 0
3 years ago
100^a x 1000^b can be written in the form 10^w <br><br> Show that w = 2a + 3b
Elena L [17]
100^a \time 1000^b = 10^{2a} \times 10^{3b} = 10^{2a + 3b}

10^{w} = 10^{2a + 3b}

w = 2a + 3b \text { (shown)}
3 0
3 years ago
Other questions:
  • 24(9) = 2x i need help with this
    9·1 answer
  • The volume of 10000 drops of liquid is 100 fluid ounces. what is the volume of 10 drops?
    15·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • The double number line shows that 111 pound of chocolate costs \$4$4dollar sign, 4.
    11·2 answers
  • 4x=3y-2 in slope intercept form<br> explain
    6·2 answers
  • Correct answer gets branliest <br><br><br> Solve the equation. Check your answer. 21= 7x+1 - 3x
    14·1 answer
  • What is the area of the shaded region
    6·2 answers
  • Is flipping a pancake rigid motion
    7·1 answer
  • Mrs. washington has a small fenced-in, rectangular play area behind her house for her dog. there is 80 feet of fencing around th
    8·1 answer
  • Sal's Sandwich Shop sells wraps and sandwiches as part of its lunch specials. The profit on every sandwich is $2, and the profit
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!