1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
4 years ago
6

The standard reduction potentials for the Ag+|Ag(s) and Zn2+| Zn(s) half-cell reactions are +0.799 V and -0.762 V, respectively.

Calculate the potential for the following electrochemical cell: Zn(s)|Zn2+(0.125 M)||Ag+(0.240 M)|Ag(s)
Chemistry
1 answer:
mihalych1998 [28]4 years ago
6 0

<u>Answer:</u> The potential of the given cell is 1.551 V

<u>Explanation:</u>

The given chemical cell follows:

Zn(s)|Zn^{2+}(0.125M)||Ag^{+}(0.240M)|Ag(s)

<u>Oxidation half reaction:</u> Zn(s)\rightarrow Zn^{2+}(0.125M)+2e^-;E^o_{Zn^{2+}/Zn}=-0.762V

<u>Reduction half reaction:</u> Ag^{+}(0.240M)+e^-\rightarrow Ag(s);E^o_{Ag^{+}/Ag}=0.799V       ( × 2)

<u>Net cell reaction:</u> Zn(s)+2Ag^{+}(0.240M)\rightarrow Zn^{2+}(0.125M)+2Ag(s)

Oxidation reaction occurs at anode and reduction reaction occurs at cathode.

To calculate the E^o_{cell} of the reaction, we use the equation:

E^o_{cell}=E^o_{cathode}-E^o_{anode}

Putting values in above equation, we get:

E^o_{cell}=0.799-(-0.762)=1.561V

To calculate the EMF of the cell, we use the Nernst equation, which is:

E_{cell}=E^o_{cell}-\frac{0.059}{n}\log \frac{[Zn^{2+}]}{[Ag^{+}]^2}

where,

E_{cell} = electrode potential of the cell = ? V

E^o_{cell} = standard electrode potential of the cell = +1.561 V

n = number of electrons exchanged = 2

[Zn^{2+}]=0.125M

[Ag^{+}]=0.240M

Putting values in above equation, we get:

E_{cell}=1.561-\frac{0.059}{2}\times \log(\frac{(0.125)}{(0.240)^2})

E_{cell}=1.551V

Hence, the potential of the given cell is 1.551 V

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
How many different types of toxins do molds make that can end up on our food and in our bodies?
Elis [28]

Answer:

I think it's more than 100,000 mold

4 0
2 years ago
What is the ground state electron configuration for magnesium?
Stella [2.4K]
Magnesium :

<span>[Ne] 3s²</span>

Answer A

hope this helps!

5 0
3 years ago
What is the mole fraction of NaOH in an aqueous solution that
astraxan [27]

Answer:

The mole fraction of NaOH in an aqueous solution that contain 22.9% NaOH by mass=0.882

Explanation:

We are given that

Aqueous solution that contains 22.9% NaOH by mass means

22.9 g NaOH in 100 g solution.

Mass of NaOH(WB)=22.9 g

Mass of water =100-22.9=77.1

Na=23

O=16

H=1.01

Molar mass of NaOH(MB)=23+16+1.01=40.01

Number of moles =\frac{Given\;mass}{Molar\;mass}

Using the formula

Number of moles of  NaOH(n_B)=\frac{W_B}{M_B}=\frac{22.9}{40.01}

n_B=0.572moles

Molar mass of water=16+2(1.01)=18.02g

Number of moles of water(n_A)=\frac{77.1}{18.02}

n_A=4.279 moles

Now, mole fraction of NaOH

=\frac{n_B}{n_B+n_A}

=\frac{4.279}{0.572+4.279}

=0.882

Hence, the mole fraction of NaOH in an aqueous solution that contain 22.9% NaOH by mass=0.882

4 0
3 years ago
Why is it that 85.48 rounded to two significant figures is 85 and not 86?
Gelneren [198K]

Answer:

See below.

Explanation:

That is because  of the .48.

85.48 is closer to 85 than 86.

8 0
3 years ago
Other questions:
  • What is always conserved in a chemical reaction?
    14·1 answer
  • AgNO3 and NaOH were combined in the first reaction. If you were to use a scale to find the mass of the AgNO3 and the NaOH before
    11·1 answer
  • A solution contains a mixture of pentane and hexane at room temperature. The solution has a vapor pressure of 246 torr . Pure pe
    9·1 answer
  • What is the chemical formula of carbon dioxide?
    6·1 answer
  • V. = 22.4 L; P= 1 atm;<br> P, = ? atm; V, = 2.8 L
    14·1 answer
  • Explain the relationship between isotopes,<br> neutrons, atomic mass, and protons.
    7·2 answers
  • Hydrogen gas, iodine vapor, hydrogen iodine are mixed in a flask and heated to 696°C. H2(g) + I2(g) ⇋ 2 HI(g) Kc = 52 at 696°C I
    14·1 answer
  • Can someone help? Ill give brainliest!
    5·1 answer
  • Plz helpppppppppppppppppp
    12·1 answer
  • Identify different hydro-meteorological hazards;
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!